Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10584

Rgs11 regulator of G-protein signaling 11 ( MGI:1354739)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584
"Pseudo-wholemount" of euxassay_000824. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000824_01 euxassay_000824_02 euxassay_000824_03 euxassay_000824_04
EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584
euxassay_000824_05 euxassay_000824_06 euxassay_000824_07 euxassay_000824_08 euxassay_000824_09
EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584
euxassay_000824_10 euxassay_000824_11 euxassay_000824_12 euxassay_000824_13 euxassay_000824_14
EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584
euxassay_000824_15 euxassay_000824_16 euxassay_000824_17 euxassay_000824_18 euxassay_000824_19
EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584 EMAGE:10584
euxassay_000824_20 euxassay_000824_21 euxassay_000824_22 euxassay_000824_23 euxassay_000824_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10584Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10584_wholemount_strong.wlz
10584_wholemount_moderate.wlz
10584_wholemount_weak.wlz
10584_wholemount_possible.wlz
10584_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10584_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 12 13 14 15 16
olfactory cortex mantle layer
strong strong
single cellstrong expression: see section 12 13 14 16 18
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 17 18 19 20
midbrain mantle layer
strong strong
single cellstrong expression: see section 12 13 14 15
facial vii ganglion
strong strong
single cellstrong expression: see section 06 07 08 21 22 23
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 08 09 19
trigeminal v ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
vagus x ganglion
strong strong
single cellstrong expression: see section 07 08 09 19 20 21
vestibulocochlear viii ganglion
strong strong
single cellstrong expression: see section 22
ventral grey horn
strong strong
single cellstrong expression: see section 11 12 13 14 15 16 17
hypogastric plexus
strong strong
single cellstrong expression: see section 17
dorsal root ganglion
strong strong
single cellstrong expression: see section 09 10 11 12 13 17 18 19
inner ear
strong strong
regionalstrong expression: see section 03
nasal cavity olfactory epithelium
strong strong
homogeneousstrong expression: see section 09 10 11 12 14 16 17 18 19 20 21
nasal cavity respiratory epithelium
strong strong
homogeneousstrong expression: see section 13
vomeronasal organ epithelium
strong strong
homogeneousstrong expression: see section 13 16
lower jaw molar
strong strong
regionalstrong expression: see section 08
seminiferous cord
strong strong
homogeneousstrong expression: see section 06 07 08 09 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3939
Entity Detected:Rgs11, regulator of G-protein signaling 11 ( MGI:1354739)
Sequence:sense strand is shown

>T3939
AGGCGTGAGTGAGAGACAGCAAGAGTCCCTTCCCAACCCCTGGTACAGCTTAGTCCCCGAGACCACCCTG
CACCGCCCTCTGGATCCCCCAGGTACCTGAAGTTCAGCAGCCAGCACGGGCCGCACGATCCCATCATGTC
AGGGTGTCTGCCCAGCAACCCCTGGATCACAGATGATGTCACCTACTGGGCCATGAATGCGCCCAACGTG
GCTGCCCCCACAAAACTCCGCGTTGAGCGATGGAGCTTCAGCTTCCGGGAGCTGCTGGATGACCCCGTGG
GGCGTGCCCACTTCATGGACTTTCTCCAGAAGGAATTCAGTGCGGAAAACCTCAGCTTCTGGGAGGCATG
TGAGGAGCTGCGCTTTGGCGGACAGGCCCAGGTCCCCACCTTGGTGGACTCTGTGTATCAGCAGTTCCTG
GCCCCTGGAGCTGCCCGCTGGATCAACATTGACAGCAGGACGATGGAGCGGACCCTGGAGGGGCTGCGCC
AGCCACACCGCTATGTCCTGGATGCAGCACAGCTTCACATCTACATGCTCATGAAGAAGGACTCCTATCC
AAGGTTCCTGAAGTCTGACATATACAAGGGCCTGCTGGAGGAAGCTGTGATTCCACTGGAGACAAAGCGC
TGGCCATTTCCATTCTTGCGGAAGCCTCTGCACTCAAGCCCCAGCCCTGCTCTCCAGTCTACCCCCAGGG
AGCCTGCAGCAACCAGTTCCCCTGAAGGTGCCAATGGGGAGTAGTAGGTGGCTCTTGCTGCATACCTCAC
CTTACCATCACCTGCCTGACACCCTGTGGGGTTGTGTTCTCCTAACGGAGATTCCCCAGCACTGGCATCA
CTGTGTACACAGTGAGGTCCTTTAGTCTTCAGTTCAGGACTAGGCTGTCTCAACTCTAGAATGTCAAGTC
AGTGACACATGAGGAGGTATCAGTCTCTGGCCATGCCACCCCATGCAGGAAGGCTCCTCCACTGTATAAT
CCTCCTCAGGCTAAACCCAGTGGCTTCTTAGGAGACGATGTCTGCAGGTGCCATGTCATTGCCGTACGTG
GCGTCTCTTCCACCTGTCGTCTGATCAGCTCTCTAGAAAGGCGACAGCACACTGCTGTCCTGACTACAGG
GCTCCCAGTTCTCATCGGGCAAGTCTTTGTCAAGCTGGCAGCCCTGGCATCCAGTCTTCCTGTCCAGGTT
GTTCAGTGCCACCAGCATTGCCACCCCCACCCCAGAGGTAGAAATAAAGATGGGGCCTCCTGCCATGCAG
CTCCCAATAGGGCTGCTCTCTAGTCTCCCTTCACAACCCATTTTCACAGAAATAAAACTTTCAGTCCCCT
GAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3666182 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3666182 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10582 same embryo
 EMAGE:10586 same embryo
 EMAGE:10581 same embryo
 EMAGE:10583 same embryo
 EMAGE:10585 same embryo
 EurExpress:euxassay_000824 same experiment
 MGI:4827717 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS