Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10772

Hprt hypoxanthine guanine phosphoribosyl transferase ( MGI:96217)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772
"Pseudo-wholemount" of euxassay_002873. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002873_01 euxassay_002873_02 euxassay_002873_03 euxassay_002873_04
EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772
euxassay_002873_05 euxassay_002873_06 euxassay_002873_07 euxassay_002873_08 euxassay_002873_09
EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772
euxassay_002873_10 euxassay_002873_11 euxassay_002873_12 euxassay_002873_13 euxassay_002873_14
EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772 EMAGE:10772
euxassay_002873_15 euxassay_002873_16 euxassay_002873_17 euxassay_002873_18 euxassay_002873_19
EMAGE:10772 EMAGE:10772
euxassay_002873_20 euxassay_002873_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10772Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10772_wholemount_strong.wlz
10772_wholemount_moderate.wlz
10772_wholemount_weak.wlz
10772_wholemount_possible.wlz
10772_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10772_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 13 14 15
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 19 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 weak expression: see section 08 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 06 07 08 09 10 11
esophagus
moderate moderate
regionalmoderate expression: see section 12
stomach
moderate moderate
regionalmoderate expression: see section 09
hindgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 04 19 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17 18
liver lobe
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1058
Entity Detected:Hprt, hypoxanthine guanine phosphoribosyl transferase ( MGI:96217)
Sequence:sense strand is shown

>T1058
CCTCGAGCCTGTTGGCCTACTGGATTGCTGAGGCGGCGAGGGAGAGCGTTGGGCTTACCTCACTGCTTTC
CGGAGCGGTAGCACCTCCTCCGCCGGCTTCCTCCTCAGACCGCTTTTTGCCGCGAGCCGACCGGTCCCGT
CATGCCGACCCGCAGTCCCAGCGTCGTGATTAGCGATGATGAACCAGGTTATGACCTAGATTTGTTTTGT
ATACCTAATCATTATGCCGAGGATTTGGAAAAAGTGTTTATTCCTCATGGACTGATTATGGACAGGACTG
AAAGACTTGCTCGAGATGTCATGAAGGAGATGGGAGGCCATCACATTGTGGCCCTCTGTGTGCTCAAGGG
GGGCTATAAGTTCTTTGCTGACCTGCTGGATTACATTAAAGCACTGAATAGAAATAGTGATAGATCCATT
CCTATGACTGTAGATTTTATCAGACTGAAGAGCTACTGTAATGATCAGTCAACGGGGGACATAAAAGTTA
TTGGTGGAGATGATCTCTCAACTTTAACTGGAAAGAATGTCTTGATTGTTGAAGATATAATTGACACTGG
TAAAACAATGCAAA
Notes:The probe template was PCR amplified from IMAGE:2099370 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099370 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10774 same embryo
 EMAGE:10771 same embryo
 EMAGE:10773 same embryo
 EurExpress:euxassay_002873 same experiment
 MGI:4825446 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS