Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11233

Cdh2 cadherin 2 ( MGI:88355)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233
"Pseudo-wholemount" of euxassay_001234. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001234_01 euxassay_001234_02 euxassay_001234_03 euxassay_001234_04
EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233
euxassay_001234_05 euxassay_001234_06 euxassay_001234_07 euxassay_001234_08 euxassay_001234_09
EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233
euxassay_001234_10 euxassay_001234_11 euxassay_001234_12 euxassay_001234_13 euxassay_001234_14
EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233
euxassay_001234_15 euxassay_001234_16 euxassay_001234_17 euxassay_001234_18 euxassay_001234_19
EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233 EMAGE:11233
euxassay_001234_20 euxassay_001234_21 euxassay_001234_22 euxassay_001234_23 euxassay_001234_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11233Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11233_wholemount_strong.wlz
11233_wholemount_moderate.wlz
11233_wholemount_weak.wlz
11233_wholemount_possible.wlz
11233_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11233_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 21 22 23 24 moderate expression: see section 06 07 08 09 10 19 20
c2 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c2 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
c3 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c3 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
c4 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c4 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
c5 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c5 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
c6 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c6 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
c7 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 not examined expression: see section 14
c7 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
l1 vertebra
moderate moderate
regionalmoderate expression: see section 15
l2 vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 15
l3 vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 15
l4 vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 15
l5 vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 15
t1 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
t2 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14
t2 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
t3 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14
t3 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
not examined not examined
regionalnot examined expression: see section 14
t4 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
t5 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14
t5 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
t6 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14
t6 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14
t7 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t7 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t8 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t8 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t9 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t9 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t10 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t10 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t11 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t11 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t12 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t12 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
t13 nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
t13 annulus fibrosus
moderate moderate
regionalmoderate expression: see section 14 15
forelimb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06
hindlimb
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 24
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 1 skin
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08
hindlimb digit 2 skin
moderate moderate
regionalmoderate expression: see section 07 08 24
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08
hindlimb digit 3 skin
moderate moderate
regionalmoderate expression: see section 08 24
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08
hindlimb digit 4 skin
moderate moderate
regionalmoderate expression: see section 08 24
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08
hindlimb digit 5 skin
moderate moderate
regionalmoderate expression: see section 24
leg
moderate moderate
regionalmoderate expression: see section 01 02 03 04
head mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21 22 23 24
foregut-midgut junction
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22
brain
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pituitary gland
moderate moderate
homogeneousmoderate expression: see section 11 12 13 15 16 17 weak expression: see section 14
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 17 18 19 20 moderate expression: see section 14 15 16
neural retina
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 16 17 18 19 20 21
tongue
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
stomach
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 moderate expression: see section 02 03
hindgut
strong strong
regionalstrong expression: see section 16 17 18 19
midgut
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22
lower lip
moderate moderate
regionalmoderate expression: see section 09 12 13 14 15 16 17 18 19 20 21
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 14 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 10 19 20 21 22 23
upper lip
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 10 19 20 21 22 23
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 19 20 21 22 23
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19
axial skeleton lumbar region
moderate moderate
regionalmoderate expression: see section 16 17 18
axial skeleton sacral region
moderate moderate
regionalmoderate expression: see section 16 17 18 19
chondrocranium
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 24 weak expression: see section 08 21 22 23
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4893
Entity Detected:Cdh2, cadherin 2 ( MGI:88355)
Sequence:sense strand is shown

>T4893
CCCACGCGTCCGGCCGCTGCCGCTTCTGCTGCCTCTGCTGCCGCCGCCGCCGCCTCCGGCTCCTCGCTCG
GCCCCTCTCCGCCTCCATGTGCCGGATAGCGGGAGCGCCGCGGACCCTGCTGCCGCTTCTGGCGGCCTTG
CTTCAGGCGTCTGTGGAGGCTTCTGGTGAAATTGCATTATGCAAGACTGGATTTCCTGAAGATGTTTACA
GCGCAGTCTTACCGAAGGATGTGCACGAAGGACAGCCCCTTCTCAATGTGAAATTCAGCAACTGCAATAG
AAAAAGGAAAGTTCAGTATGAAAGCAGCGAGCCAGCAGATTTCAAGGTGGACGAGGACGGCACGGTGTAT
GCTGTGAGAAGCTTCCCTCTCACTGCAGAGCAGGCAAAGTTCCTGATATATGCCCAAGACAAAGAAACCC
AGGAAAAGTGGCAGGTAGCTGTAAACCTGAGCCGGGAGCCAACCCTGACTGAGGAGCCTATGAAGGAACC
ACATGAAATTGAAGAAATAGTATTCCCTAGACAACTTGCCAAGCACAGTGGAGCTCTACAAAGGCAGAAG
AGAGACTGGGTCATCCCGCCAATCAACTTGCCAGAAAACTCCAGAGGACCCTTTCCTCAAGAGCTTGTCA
GAATCAGGTCTGATAGAGATAAAAACCTTTCCCTGAGATACAGCGTCACTGGGCCAGGAGCTGACCAGCC
TCCAACGGGCATCTTCATTATCAACCCCATCTCAGGACAGCTGTCAGTCACAAAGCCTCTGGATCGAGAG
CTGATAGCCCGGTTTCACTTGAGAGCACATGCAGTGGACATCAATGGCAATCAAGTGGAGAACCCCATTG
ACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTC
TGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAAT
GCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTA
CAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTA
TACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCC
GTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCC
CTGAGAACAGGGTGGACGTCATTGTAGCCAACCTAACTGTCACGGACAAAGATCAGCCCCACACGCCGGC
CTGGAATGCGGCATACAGAATCAGTGGTGGAGACCCTACAGGAAGGTTTGCCATCCTGACAGACCCCAAC
AGCAATGATGGGCTAGTCACAGTGGTAAAACCAATTGACTTTGAAACGAATAGGATGTTTGTCCTTACTG
TTGCTGCAGAAAACCAAGTGCCATTAGCTAAAGGCATTCAGCACCCACCTCAGTCGACAGCCACTGTGTC
TGTGACAGTTATTGATGTCAATGAAAATCCTTATTTTGCCCCAAATCCTAAAATCATTCGCCAAGAGGAA
GGCCTCCACGCAGGTACCATGCTGACCACGCTCACTGCTCAGGACCCCGATCGATATATGCAACAGAATA
TCAGATACACAAAATTGTCTGATCCTGCCAACTGGCTGAAAATAGACCCCGTGAATGGGCAGATCACTAC
TATTGCCGTTTTGGACAGAGAATCGCCAAATGTAAAAAACAACATCTATAATGCTACCTTCCTTGCTTCT
GACAATGGAATCCCGCCTATGAGTGGGACAGGAACACTGCAAATCTATTTACTTGATATCAATGACAACG
CCCCTCAGGTGTTACCTCAAGAGGCAGAGACCTGTGAAACTCCAGAACCCAACTCAATTAACATCACAGC
ACTTGATTATGACATAGACCCAAACGCCGGGCCATTCGCGTTTGATCTTCCCTTATCTCCAGTGACTATT
AAAAGAAACTGGACCATCAACCGGCTTAATGGTGATTTTGCTCAGCTCAATTTAAAGATAAAATTTTTGG
AAGCTGGTATCTATGAAGTTCCCATCATTATCACAGATTCAGGGAATCCCCCCAAGTCCAACATTTCCAT
CCTGCGTGTGAAAGTTTGCCAGTGTGACTCCAATGGAGACTGCACGGACGTGGACAGGATCGTGGGTGCA
GGGCTTGGCACGGGTGCCATCATCGCTATCCTTCTGTGTATCATCATCCTGCTGATCCTTGTTCTCATGT
TTGTGGTATGGATGAAACGGCGGGATAAAGAGCGCCAAGCCAAGCAGCTTTTAATTGACCCAGAAGATGA
TGTAAGAGATAATATATTGAAATATGATGAAGAAGGTGGAGGAGAAGAAGACCAGGACTATGACTTGAGC
CAGCTCCAGCAACCAGATACTGTGGAGCCTGATGCCATCAAGCCCGTGGGAATCAGACGGCTAGACGAGA
GGCCTATCCATGCTGAGCCACAGTACCCAGTCCGATCCGCAGCCCCACACCCTGGGGATATTGGGGACTT
CATTAATGAGGGCCTTAAAGCTGCTGACAACGACCCCACGGCGCCACCGTATGACTCCCTCTTAGTCTTT
GACTACGAGGGCAGCGGCTCCACGGCTGGCTCCTTGAGCTCCCTCAACTCCTCCAGTAGCGGTGGGGACC
AGGACTATGACTACCTGAATGACTGGGGACCCCGCTTCAAGAAACTGGCGGACATGTACGGCGGTGGTGA
CGACTGAACGGCAGGACGGACTTGGCTTTTGGACAAGTATGAACAGTTTCACCTGATATTCCCAAAAAAA
AGCATACAGAAGCTAGGCTTTAACTCTGTAGTCCACTAGCACCGTGCTTGCTGGAGGCTTTGGCGTAGGC
TGCGAACCAGTTTGGGCTCCCAGGGAATATCAGTGATCCAATACTGTCTGGAAAACACCGAGCTCAGCTA
CACTTGAATTTTACAGTAAAGAAGCACTGGGATTTATGTGCCTTTTTGTACCTTTTTCAGATTGGAATTA
GTTTTCTGTTTAAGGCTTTAATGGTACTGATTTCTGAAATGATAAGGAAAAGACAAAATATTTTGTGGCG
GGAGCAGAAAGTTAAATGTGATACGCTTCAACCCACTTTTGTTACAATGCATTTGCTTTTGTTAAGATAC
AGAACGAAACAACCAGATTAAAAAAAATTAACTCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5100313 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5100313 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11232 same embryo
 EMAGE:11230 same embryo
 EMAGE:11229 same embryo
 EMAGE:11231 same embryo
 EMAGE:11228 same embryo
 EurExpress:euxassay_001234 same experiment
 MGI:4823768 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS