Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12748

Phf14 PHD finger protein 14 ( MGI:1923539)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748
"Pseudo-wholemount" of euxassay_011481. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011481_01 euxassay_011481_02 euxassay_011481_03 euxassay_011481_04
EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748
euxassay_011481_05 euxassay_011481_06 euxassay_011481_07 euxassay_011481_08 euxassay_011481_09
EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748
euxassay_011481_10 euxassay_011481_11 euxassay_011481_12 euxassay_011481_13 euxassay_011481_14
EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748
euxassay_011481_15 euxassay_011481_16 euxassay_011481_17 euxassay_011481_18 euxassay_011481_19
EMAGE:12748 EMAGE:12748 EMAGE:12748 EMAGE:12748
euxassay_011481_20 euxassay_011481_21 euxassay_011481_22 euxassay_011481_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12748Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12748_wholemount_strong.wlz
12748_wholemount_moderate.wlz
12748_wholemount_weak.wlz
12748_wholemount_possible.wlz
12748_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12748_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 03 04 20 21 22 23
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 03 04 20 21
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 04 05 20
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 20
thymus primordium
weak weak
regionalweak expression: see section 13 14 15 16 17
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 18 19 20 21
forebrain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 08 09 21 22
hindbrain
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain
weak weak
homogeneousweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 20 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 10 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08 09 19 20 21
trigeminal v nerve
weak weak
regionalweak expression: see section 10 18
spinal cord
weak weak
homogeneousweak expression: see section 11 12 13 14 15 16 17 18 19
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 18 19 20
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03
esophagus
weak weak
regionalweak expression: see section 15
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 08
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 08
renal cortex
weak weak
regionalweak expression: see section 09 10 11 12 19 20 21 22 23
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30309
Entity Detected:Phf14, PHD finger protein 14 ( MGI:1923539)
Sequence:sense strand is shown

>T30309
CATGTCACCTGTGCCCAAAAGGAAGGCCTGCTATCAGAGGCAGCAGCAGAAGAGGATATAGCAGATCCAT
TTTTTGCTTATTGTAAGCAGCATGCAGACAGATTAGACAGAAAATGGAAAAGAAAAAACTACTTGGCTCT
ACAATCCTATTGTAAAATGTCTTTGCAAGAGAGAGAAAAACAGCTGTCCCCTGAAGCACAGGCAAGGATC
AATGCCCGACTACAGCAATATCGTGCCAAGGCAGAGCTGGCGCGATCTACCAGACCACAAGCCTGGGTTC
CAAGGGAAAAGCTACCCAGGCCACTGACAAGTAGTGCTTCGGCTATTCGTAAGCTTATGCGCAAAGCAGA
GCTGATGGGAATCAGTACGGATATCTTTCCAGTGGACAACTCAGATACTAGTTCTAGTGTGGATGGAAGG
CGGAAGCATAAGCAGCCCGCTCTCACTGCTGATTTTGTGAATTACTATTTTGAGAGAAATATGCGCATGA
TTCAAATTCAGGAAAATATGGCTGAACAAAAGAATATAAAGGATAAATTAGAGAATGAGCAAGAAAAGCT
TCATGTAGAATATAATAAGCTCTGTGAATCATTAGAGGAACTGCAAAATCTGAATGGGAAACTTCGAAGT
GAAGGGCAAGGGATATGGGCCTTACTTGGCCGAATTACAGGGCAGAAGTTGAATGTACCAGCAATCTTAC
GAGCACCTAAGGAAAGGAAACCAAGTAAAAAAGAAGGAGGCACACAAAAGACATCTGCTCTTCCTACAGT
GCTTTATAGTTGTGGAATTTGTAAGAAGAACCATGATCAGCATCTTCTTTTACTGTGTGACACCTGTAAA
CTGCATTATCATCTCGGCTGCCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3585881), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 28934. Forward Primer - name:028934_F_IRAV77-80_K02_4932409F11Rik, sequence:CATGTCACCTGTGCCCAA; Reverse Primer - name:028934_R_SP6_IRAV77-80_K02_4932409F11Rik, sequence:CAAGGCAGCCGAGATGAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12753 same embryo
 EMAGE:12751 same embryo
 EMAGE:12750 same embryo
 EMAGE:12749 same embryo
 EMAGE:12752 same embryo
 EurExpress:euxassay_011481 same experiment
 MGI:4827184 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS