Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12855

Ivns1abp influenza virus NS1A binding protein ( MGI:2152389)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855
"Pseudo-wholemount" of euxassay_011634. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011634_01 euxassay_011634_02 euxassay_011634_03 euxassay_011634_04
EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855
euxassay_011634_05 euxassay_011634_06 euxassay_011634_07 euxassay_011634_08 euxassay_011634_09
EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855
euxassay_011634_10 euxassay_011634_11 euxassay_011634_12 euxassay_011634_13 euxassay_011634_14
EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855
euxassay_011634_15 euxassay_011634_16 euxassay_011634_17 euxassay_011634_18 euxassay_011634_19
EMAGE:12855 EMAGE:12855 EMAGE:12855 EMAGE:12855
euxassay_011634_20 euxassay_011634_21 euxassay_011634_22 euxassay_011634_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12855Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12855_wholemount_strong.wlz
12855_wholemount_moderate.wlz
12855_wholemount_weak.wlz
12855_wholemount_possible.wlz
12855_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12855_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
weak weak
regionalweak expression: see section 05 06 21 22
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 12 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19
pancreas
weak weak
regionalweak expression: see section 11 12 13 14
thyroid gland
weak weak
regionalweak expression: see section 11 12 16
pituitary gland
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 12
vibrissa
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 08 20 21 22 23 weak expression: see section 04 05
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
corpus striatum
moderate moderate
regionalmoderate expression: see section 05 06 07 19 21 22 weak expression: see section 04
lateral ventricle
moderate moderate
regionalmoderate expression: see section 20
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 17 weak expression: see section 12 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 17
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 03 04 05 06 07 08 14 15 16 17 18 19 20 21 weak expression: see section 09 10 11 12
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 moderate expression: see section 09 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18 weak expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 13 17 weak expression: see section 08 11 12 18 19
saccule
weak weak
regionalweak expression: see section 05 06 07 08 18 19
cochlea
weak weak
regionalweak expression: see section 09 10 17
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 22 weak expression: see section 03 04
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 weak expression: see section 19
heart ventricle
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
stomach
strong strong
regionalstrong expression: see section 06 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
lower lip
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 20
mandible
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 06 07 08 09 10 11 12 18 19 20 21 22 23
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 08 19
upper lip
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22
maxilla
weak weak
regionalweak expression: see section 06 09 18 21
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 08 19 20
urinary system
strong strong
regionalstrong expression: see section 07 23
metanephros
strong strong
regionalstrong expression: see section 09 10 11 12 13 18 19 20 21 22
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 weak expression: see section 16
trachea
moderate moderate
regionalmoderate expression: see section 14 15
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 01 02 03 04 21 22 23
clavicle
moderate moderate
regionalmoderate expression: see section 09 10 11 17
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31654
Entity Detected:Ivns1abp, influenza virus NS1A binding protein ( MGI:2152389)
Sequence:sense strand is shown

>T31654
CATTTTCCTTCATGGGCGGAACAGTCCACAGAGCTCACCAACAAGTACTCCAAAACTGAGCAAGAGTTTA
AGCTTCGAGATGCAACCAGATGAGCTTCTAGAAAAGCCCATGTCTCCCATGCAGTACGCACGGTCTGGAC
TAGGGACAGCAGAGATGAATGGCAAACTCATAGCTGCAGGTGGTTATAACAGAGAGGAATGTCTTCGAAC
AGTTGAATGCTATGATCCACATACAGATCACTGGTCCTTCCTTGCTCCCATGAGAACACCAAGAGCCCGC
TTTCAAATGGCTGTGCTGATGGGACAGCTCTATGTGGTGGGTGGATCAAATGGACACTCAGATGACCTGA
GTTGTGGAGAAATGTATGATCCAAACATTGATGACTGGACCCCTGTTCCAGAGCTGAGAACCAACCGTTG
TAATGCAGGAGTGTGTGCTCTGAATGGGAAATTGTACATTGTTGGTGGCTCTGATCCATATGGTCAAAAG
GGCCTGAAAAATTGTGATGTATTTGATCCTGTAACGAAGTCATGGACAAGCTGTGCTCCTCTTAACATTC
GTCGACACCAGTCTGCAGTTTGTGAACTTGGTGGTTATTTGTATATAATTGGAGGTGCAGAATCTTGGAA
TTGTCTGAACACAGTAGAACGATACAATCCTGAAAACAACACCTGGACTTTAATTGCATCCATGAATGTG
GCGAGGCGAGGGGCTGGAGTCGCTGTGCTTGATGGAAAACTGTTTGTAGGTGGTGGCTTTGATGGTTCTC
ACGCCATCAGTTGTGTGGAGATGTATGATCCAACTAGAAATGAATGGAAGATGATGGGAAATATGACTTC
ACCAAGGAGCAATGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3593827), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 15027. Forward Primer - name:015027_F_IRAV08-11_K20_Ivns1abp, sequence:CATTTTCCTTCATGGGCG; Reverse Primer - name:015027_R_SP6_IRAV08-11_K20_Ivns1abp, sequence:CCAGCATTGCTCCTTGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12857 same embryo
 EMAGE:12854 same embryo
 EMAGE:12856 same embryo
 EMAGE:12859 same embryo
 EMAGE:12858 same embryo
 EurExpress:euxassay_011634 same experiment
 MGI:4825669 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS