Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12973

Ide insulin degrading enzyme ( MGI:96412)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973
"Pseudo-wholemount" of euxassay_013741. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013741_01 euxassay_013741_02 euxassay_013741_03 euxassay_013741_04
EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973
euxassay_013741_05 euxassay_013741_06 euxassay_013741_07 euxassay_013741_08 euxassay_013741_09
EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973
euxassay_013741_10 euxassay_013741_11 euxassay_013741_12 euxassay_013741_13 euxassay_013741_14
EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973
euxassay_013741_15 euxassay_013741_16 euxassay_013741_17 euxassay_013741_18 euxassay_013741_19
EMAGE:12973 EMAGE:12973 EMAGE:12973 EMAGE:12973
euxassay_013741_20 euxassay_013741_21 euxassay_013741_22 euxassay_013741_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12973Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12973_wholemount_strong.wlz
12973_wholemount_moderate.wlz
12973_wholemount_weak.wlz
12973_wholemount_possible.wlz
12973_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12973_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 20 21 22 23
adrenal medulla
strong strong
regionalstrong expression: see section 10 17 18 19
spleen primordium
strong strong
regionalstrong expression: see section 07 08
thymus primordium
strong strong
regionalstrong expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 16 17 18 19 20
pancreas
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
thyroid gland
moderate moderate
regionalmoderate expression: see section 11 12 16 17
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 17 18 19 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 18 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 09 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 17 18 19 20
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 13 14
external naris epithelium
moderate moderate
regionalmoderate expression: see section 10 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 10 13
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
stomach
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 03 04 05 06 07 08
rectum
strong strong
regionalstrong expression: see section 13
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 moderate expression: see section 07 08
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 16 17 18 19 20 21 22 23
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 07 19 moderate expression: see section 06 08
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 16 17 18 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 07 19 moderate expression: see section 06 08
liver
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23 moderate expression: see section 02 03 04 12 13 14 15
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13
renal cortex
strong strong
regionalstrong expression: see section 08 09 10 11 16 17 18 19 20
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13
left lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
right lung
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22 23
trachea
moderate moderate
regionalmoderate expression: see section 14 15
clavicle
strong strong
regionalstrong expression: see section 10 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32045
Entity Detected:Ide, insulin degrading enzyme ( MGI:96412)
Sequence:sense strand is shown

>T32045
ACAGAAGGAAGGAGCCCGAGGTTTTATGTTTTTTATCATTAATGTGGACTTAACTGAAGAAGGGTTATTG
CACGTTGAAGATATAATTTTGCACATGTTTCAATACATTCAGAAGCTACGTGCAGAAGGACCTCAAGAAT
GGGTTTTCCAAGAGTGCAAGGACTTGAATGCTGTTGCTTTCAGATTTAAAGATAAAGAGAGACCACGAGG
CTATACGTCCAAGATTGCAGGAAAGTTGCACTATTATCCCCTAAATGGAGTGCTCACAGCTGAATATCTA
TTGGAGGAATTTAGACCCGACTTGATAGACATGGTTCTTGATAAACTCAGACCAGAAAATGTGCGGGTGG
CAATAGTTTCCAAATCATTTGAAGGGAAAACTGACCGCACAGAGCAGTGGTATGGAACACAGTATAAGCA
AGAAGCTATCCCAGAGGACATCATTCAGAAATGGCAAAATGCTGACCTTAATGGAAAATTTAAGCTTCCA
ACAAAGAATGAATTTATTCCCACAAATTTTGAGATTTTGTCATTAGAAAAAGATGCAACACCATACCCTG
CTCTTATTAAGGATACAGCCATGAGTAAGCTGTGGTTCAAACAAGATGATAAATTTTTCTTGCCGAAAGC
TTGTCTCAACTTTGAATTTTTCAGCCCGTTTGCTTATGTGGACCCCTTGCACTGTAACATGGCCTATTTG
TACCTTGAGCTCCTCAAAGACTCACTCAACGAGTATGCATATGCAGCAGAGCTAGCAGGCCTGAGCTATG
ACCTCCAAAATACCATCTATGGGATGTATCTCTCAGTGAAAGGTTACAATGACAAACAGCCAATTTTGCT
GAAGAAGATCACCGAGAAAATGGCTACTTTTGAGATTGATAAGAAGAGATTTGAAATTATCAAAGAGGCC
TATATGCGATCTCTTAATAACTTCCGGGCTGAGCAGCCTCACCAGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4951971), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57909. Forward Primer - name:057909_F_IRAV88_c06_Ide, sequence:ACAGAAGGAAGGAGCCCG; Reverse Primer - name:057909_R_SP6_IRAV88_c06_Ide, sequence:ATGCTGGTGAGGCTGCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12974 same embryo
 EMAGE:12977 same embryo
 EMAGE:12975 same embryo
 EMAGE:12976 same embryo
 EMAGE:12972 same embryo
 EurExpress:euxassay_013741 same experiment
 MGI:4825499 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS