Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14449

Foxp2 forkhead box P2 ( MGI:2148705)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449
"Pseudo-wholemount" of euxassay_004284. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004284_01 euxassay_004284_02 euxassay_004284_03 euxassay_004284_04
EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449
euxassay_004284_05 euxassay_004284_06 euxassay_004284_07 euxassay_004284_08 euxassay_004284_09
EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449
euxassay_004284_10 euxassay_004284_11 euxassay_004284_12 euxassay_004284_13 euxassay_004284_14
EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449
euxassay_004284_15 euxassay_004284_16 euxassay_004284_17 euxassay_004284_18 euxassay_004284_19
EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449 EMAGE:14449
euxassay_004284_20 euxassay_004284_21 euxassay_004284_22 euxassay_004284_23 euxassay_004284_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14449Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14449_wholemount_strong.wlz
14449_wholemount_moderate.wlz
14449_wholemount_weak.wlz
14449_wholemount_possible.wlz
14449_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14449_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 24 weak expression: see section 23
foot
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 22 24 weak expression: see section 23
leg
moderate moderate
regionalmoderate expression: see section 01 02 03 24
femur
moderate moderate
regionalmoderate expression: see section 04 05 06 16 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
olfactory lobe
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 15 16 17 18 19 20
medulla oblongata lateral wall
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
metencephalon lateral wall
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
basal columns
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
ear
moderate moderate
regionalmoderate expression: see section 21
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 11 12 13 14
palatal shelf
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
bladder
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 20 21
cranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 24 weak expression: see section 21 22 23
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08
tail skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6324
Entity Detected:Foxp2, forkhead box P2 ( MGI:2148705)
Sequence:sense strand is shown

>T6324
CGGCATCAGCATGGAGGGCTAGACCTCACGACTAACAATTCCTCCTCGACTACCTCCTCCACCACGTCCA
AAGCATCACCACCCATCACACATCATTCCATAGTGAACGGACAGTCTTCAGTTCTGAATGCAAGGCGGGA
CAGCTCATCACATGAGGAGACTGGGGCCTCGCACACTCTCTATGGCCATGGAGTCTGCAAGTGGCCAGGC
TGTGAAAGCATATGTGAAGATTTTGGACAGTTTTTGAAGCACCTTAACAATGAGCATGCATTGGATGACC
GAAGCACTGCCCAATGTCGAGTGCAAATGCAGGTGGTACAGCAGTTAGAAATACAGCTTTCTAAGGAACG
CGAACGTCTTCAAGCGATGATGACCCACTTGCACATGCGACCCTCAGAGCCCAAACCATCTCCCAAACCT
CTAAATCTGGTGTCTAGTGTCACCATGTCGAAGAACATGCTGGAGACATCCCCACAGAGCTTACCTCAAA
CCCCTACCACACCAACGGCCCCAGTCACCCCGATTACCCAGGGACCCTCTGTAATCACCCCAGCCAGTGT
GCCCAATGTGGGAGCCATACGAAGGCGACATTCAGACAAATACAACATCCCCATGTCATCAGAGATTGC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTCAGCAACTATGGAAAGAAG; Reverse Primer - name:unspecified, sequence:ATCAGTCCAGGGTTACTTAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14451 same embryo
 EMAGE:14450 same embryo
 EMAGE:14454 same embryo
 EMAGE:14453 same embryo
 EMAGE:14452 same embryo
 EurExpress:euxassay_004284 same experiment
 MGI:4824915 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS