Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15406

Sema3f sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F ( MGI:1096347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406
"Pseudo-wholemount" of euxassay_010600. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010600_01 euxassay_010600_02 euxassay_010600_03 euxassay_010600_04
EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406
euxassay_010600_05 euxassay_010600_06 euxassay_010600_07 euxassay_010600_08 euxassay_010600_09
EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406
euxassay_010600_10 euxassay_010600_11 euxassay_010600_12 euxassay_010600_13 euxassay_010600_14
EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406 EMAGE:15406
euxassay_010600_15 euxassay_010600_16 euxassay_010600_17 euxassay_010600_18 euxassay_010600_19
EMAGE:15406 EMAGE:15406 EMAGE:15406
euxassay_010600_20 euxassay_010600_21 euxassay_010600_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15406Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15406_wholemount_strong.wlz
15406_wholemount_moderate.wlz
15406_wholemount_weak.wlz
15406_wholemount_possible.wlz
15406_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15406_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 14 15 16
pancreas
weak weak
regionalweak expression: see section 06 07 08 09 12 13 14 15
pituitary gland
weak weak
regionalweak expression: see section 08 09 10 11 12 13
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 14 15 weak expression: see section 11 12 13 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 weak expression: see section 03 04 17 20
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 11 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 10 11 12 13 14 15 weak expression: see section 05 06 07 08 09
dorsal grey horn
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12
middle ear mesenchyme
weak weak
regionalweak expression: see section 06
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 15 16 17 18 19
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 17 18
esophagus
weak weak
regionalweak expression: see section 09 10
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03
bladder
moderate moderate
regionalExpression in the fundus region.
renal cortex
weak weak
regionalweak expression: see section 04 05 06 07 13 14 15 16
urethra of male
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30863
Entity Detected:Sema3f, sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F ( MGI:1096347)
Sequence:sense strand is shown

>T30863
ATGACCCCAAGCTGGACACAGCCTCAGCCCTCATCAATGAGGAACTCTATGCAGGAGTGTACATCGATTT
TATGGGTACCGATGCAGCCATTTTCCGCACGCTGGGGAAGCAGACAGCCATGCGCACAGATCAGTACAAC
TCCCGGTGGCTCAATGATCCTTCCTTCATACATGCTGAGCTCATCCCTGACAGCGCAGAGCGCAATGACG
ATAAACTCTACTTCTTCTTCCGAGAGCGCTCGGCAGAGGCGCCACAGAACCCTGCTGTGTATGCCCGCAT
CGGGCGCATCTGCCTTAACGATGACGGTGGCCATTGCTGCCTGGTCAACAAGTGGAGCACATTCCTGAAG
GCTCGGCTCGTCTGCTCCGTGCCAGGCGAGGATGGTATCGAGACCCACTTCGACGAACTCCAGGATGTGT
TTGTCCAGCAGACCCAGGACATCAGGAACCCAGTCATTTATGCTGTCTTTACCTCTTCAGGCTCTGTGTT
CCGAGGGTCTGCAGTGTGTGTCTACTCCATGGCTGATATCCGCATGGTCTTCAATGGGCCTTTTGCTCAC
AAGGAGGGCCCCAACTATCAATGGATGCCCTTCTCAGGAAAGATGCCCTATCCTCGGCCTGGCACATGCC
CTGGTGGAACCTTCACGCCCTCGATGAAGTCCACTAAGGACTACCCTGATGAAGTGATCAACTTCATGCG
CACTCATCCGCTCATGTACCAGGCCGTCTACCCGCTCCAGCGGCGACCCCTGGTGGTCCGTACAGGCGCT
CCCTACCGCCTCACCACTGTCGCTGTGGACCAGGTGGATGCAGCTGATGGACGCTATGAGGTGCTTTTCC
TGGGCACAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4219060), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 16810. Forward Primer - name:016810_F_IRAV24-27_C11_Sema3f, sequence:ATGACCCCAAGCTGGACA; Reverse Primer - name:016810_R_SP6_IRAV24-27_C11_Sema3f, sequence:TCTGTGCCCAGGAAAAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15410 same embryo
 EMAGE:15411 same embryo
 EMAGE:15407 same embryo
 EMAGE:15408 same embryo
 EMAGE:15409 same embryo
 EurExpress:euxassay_010600 same experiment
 MGI:4827947 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS