Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18299

Shc2 SHC (Src homology 2 domain containing) transforming protein 2 ( MGI:106180)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299
"Pseudo-wholemount" of euxassay_012092. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012092_01 euxassay_012092_02 euxassay_012092_03 euxassay_012092_04
EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299
euxassay_012092_05 euxassay_012092_06 euxassay_012092_07 euxassay_012092_08 euxassay_012092_09
EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299
euxassay_012092_10 euxassay_012092_11 euxassay_012092_12 euxassay_012092_13 euxassay_012092_14
EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299
euxassay_012092_15 euxassay_012092_16 euxassay_012092_17 euxassay_012092_18 euxassay_012092_19
EMAGE:18299 EMAGE:18299 EMAGE:18299 EMAGE:18299
euxassay_012092_20 euxassay_012092_21 euxassay_012092_22 euxassay_012092_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18299Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18299_wholemount_strong.wlz
18299_wholemount_moderate.wlz
18299_wholemount_weak.wlz
18299_wholemount_possible.wlz
18299_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18299_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 17 18 19 20 21 22
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 weak expression: see section 04 05 21
fibula
weak weak
regionalweak expression: see section 03
tibia
weak weak
regionalweak expression: see section 02
femur
moderate moderate
regionalmoderate expression: see section 20 21 22 23 weak expression: see section 04 05 06 07 08
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 weak expression: see section 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 14 15 16 moderate expression: see section 07 09 10 11
neural retina
strong strong
regionalstrong expression: see section 01 02 20 moderate expression: see section 21 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 02 03 06 07 08 09 10 11 12 13 14 15 18 19 20
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 13 14 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 09 10 11 14
basioccipital bone
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
basisphenoid bone
weak weak
regionalweak expression: see section 10 11 12 13 14
exoccipital bone
weak weak
regionalweak expression: see section 02 03 04 05 18 19 20 21
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 20 21 22
vault of skull
weak weak
regionalweak expression: see section 01 02 03 22
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 04 05 18 19 20 21 22
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 08 17 18
scapula
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 20 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30712
Entity Detected:Shc2, SHC (Src homology 2 domain containing) transforming protein 2 ( MGI:106180)
Sequence:sense strand is shown

>T30712
CTGCCTATCGTGGCTGCTGAGAGCGAGCTGCATCTGCGGGGAGTGGTCTCTCGGGAGCCATGAGCCAGGT
GACAGTCCTCAGCCCAACTTCTACCCCTAGATGCCCTTGCTGAGGCCTTTCTCTCAGATCCTGAAGCCAC
GAGAACCAGAATGGTTACCACCTCTCCTTCCACACGAGCCCTCGGGAAGCCGCCTTTCCCAGCTGTGCTC
GCTCAGCTGGCTGGGCCCGTGAGACAGAGTCAGGGTCAAGCCTCTGCTCCCACCTGAGCCCCAACCCTGA
AGGGTGAGGGCTGTACAAACCAAAGACAGACCGAGTCGCCTTTAACGAAGACATCCAAATGCAGGCCCCG
TACCTCTGGTCCCAGTGCGAGTAGGGACATCAGGCTGTGTCCACAGTGATGTGGACAGCTCTGTGTGGGC
AGGGGTAGTGTCCTGCCCTAGCTGGGCTCTGAGGACCTAGATGCACTGTTGCTTTTGGGGGTGATTAAGG
TGCTTTTGGGTCTCAGATCCCTGATGGGGGAGCAGCCCAGGGGCTCGCCTGGCATGTAGGGTATCCAGGT
GAGTCAGAGGCAGGGGAACCTCAGTGAGGTGTGGTATCCACTCAGCACTTCCCAGCTGTCACCTGCCTGG
ACCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6417908), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60380. Forward Primer - name:060380_F_IRAV119_d10_Shc2, sequence:CTGCCTATCGTGGCTGCT; Reverse Primer - name:060380_R_SP6_IRAV119_d10_Shc2, sequence:GAAGGTCCAGGCAGGTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18300 same embryo
 EMAGE:18303 same embryo
 EMAGE:18302 same embryo
 EMAGE:18301 same embryo
 EMAGE:18304 same embryo
 EurExpress:euxassay_012092 same experiment
 MGI:4828049 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS