Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18945

Plk2 polo-like kinase 2 (Drosophila) ( MGI:1099790)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945
"Pseudo-wholemount" of euxassay_015918. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015918_01 euxassay_015918_02 euxassay_015918_03 euxassay_015918_04
EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945
euxassay_015918_05 euxassay_015918_06 euxassay_015918_07 euxassay_015918_08 euxassay_015918_09
EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945
euxassay_015918_10 euxassay_015918_11 euxassay_015918_12 euxassay_015918_13 euxassay_015918_14
EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945 EMAGE:18945
euxassay_015918_15 euxassay_015918_16 euxassay_015918_17 euxassay_015918_18 euxassay_015918_19
EMAGE:18945 EMAGE:18945 EMAGE:18945
euxassay_015918_20 euxassay_015918_21 euxassay_015918_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18945Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18945_wholemount_strong.wlz
18945_wholemount_moderate.wlz
18945_wholemount_weak.wlz
18945_wholemount_possible.wlz
18945_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18945_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 04 05 19 20 weak expression: see section 21
interdigital region between hindlimb digits 2 and 3
strong strong
regionalstrong expression: see section 04 05 06 07 19 20 weak expression: see section 21
interdigital region between hindlimb digits 3 and 4
strong strong
regionalstrong expression: see section 05 06 07 19 20 weak expression: see section 21
interdigital region between hindlimb digits 4 and 5
strong strong
regionalstrong expression: see section 06 07 19 20
pancreas
weak weak
regionalweak expression: see section 07 08 09
vibrissa
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 03 04 05
hypothalamus mantle layer
weak weak
regionalweak expression: see section 08 09
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 07 09 10 11 12 13
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 01 02 03 04 05 06 07 08 09 18 19 21 22
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 17 18 19 moderate expression: see section 03 04 16 20 weak expression: see section 02 07
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 05 06 08 14
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 07 08 11 12 13 14
midbrain mantle layer
weak weak
regionalweak expression: see section 06 07 08 10 11 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 07 08 09 11 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 06 07 08 09 10 11 12 14 15 16
lower lip
moderate moderate
regionalmoderate expression: see section 08 10 11 12 weak expression: see section 06 07 09 13
mandible
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 05 06 14 15 19 20 21 weak expression: see section 03 16 17 18
upper lip
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 07
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 14 15 19 20 weak expression: see section 03 16 17 18
bladder
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 11
lung
moderate moderate
regionalmoderate expression: see section 01 02 03 11 16 17 18 19 weak expression: see section 04 05 06 07 08 09 10 12 13 14 15
sternum
moderate moderate
regionalmoderate expression: see section 10 11 14 weak expression: see section 06 07 08 09 12 13
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63153
Entity Detected:Plk2, polo-like kinase 2 (Drosophila) ( MGI:1099790)
Sequence:sense strand is shown

>T63153
GAAGACATTTACAAGCTTCGGCATGATTTGAAGAAAGTGTCGATAACCCAGCAGCCTAGCAAACACAGAG
CAGACGAGGAGCCCCAGCCGCCTCCCACTACTGTTGCCAGATCTGGAACGTCCGCAGTGGAAAACAAACA
GCAGATTGGGGATGCAATCCGGATGATAGTCAGGGGGACTCTCGGCAGCTGCAGCAGCAGCAGCGAATGC
CTTGAAGACAGCACCATGGGAAGTGTTGCAGACACAGTGGCAAGAGTCCTTCGAGGATGTCTAGAAAACA
TGCCGGAAGCTGACTGTATCCCCAAAGAGCAGCTGAGCACGTCCTTTCAGTGGGTCACCAAGTGGGTCGA
CTACTCCAACAAATATGGCTTTGGGTACCAGCTCTCGGACCACACTGTTGGCGTCCTTTTCAACAACGGG
GCTCACATGAGCCTCCTTCCGGACAAAAAGACAGTTCACTATTATGCGGAACTTGGCCAATGCTCTGTTT
TCCCAGCAACAGATGCCCCTGAACAATTTATTAGTCAAGTGACGGTGCTGAAATACTTTTCTCATTACAT
GGAGGAGAACCTCATGGATGGTGGTGATCTCCCGAGTGTTACTGACATTCGAAGACCTCGGCTCTACCTC
CTGCAGTGGTTAAAGTCTGATAAAGCCTTAATGATGCTCTTCAATGACGGCACATTTCAGGTGAATTTCT
ACCACGATCATACAAAAATCATCATCTGTAACCAGAGTGAAGAATACCTTCTCACCTACATCAATGAGGA
CAGGATCTCTACAACTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92944. Forward Primer - name:092944_F_cDNA_Plk2, sequence:GAAGACATTTACAAGCTTCGGC; Reverse Primer - name:092944_N_SP6_cDNA_Plk2, sequence:AAGTTGTAGAGATCCTGTCCTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18944 same embryo
 EMAGE:18942 same embryo
 EMAGE:18943 same embryo
 EurExpress:euxassay_015918 same experiment
 MGI:4827274 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS