Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19292

Npc2 Niemann Pick type C2 ( MGI:1915213)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292
"Pseudo-wholemount" of euxassay_001964. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001964_01 euxassay_001964_02 euxassay_001964_03 euxassay_001964_04
EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292
euxassay_001964_05 euxassay_001964_06 euxassay_001964_07 euxassay_001964_08 euxassay_001964_09
EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292
euxassay_001964_10 euxassay_001964_11 euxassay_001964_12 euxassay_001964_13 euxassay_001964_14
EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292
euxassay_001964_15 euxassay_001964_16 euxassay_001964_17 euxassay_001964_18 euxassay_001964_19
EMAGE:19292 EMAGE:19292 EMAGE:19292 EMAGE:19292
euxassay_001964_20 euxassay_001964_21 euxassay_001964_22 euxassay_001964_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19292Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19292_wholemount_strong.wlz
19292_wholemount_moderate.wlz
19292_wholemount_weak.wlz
19292_wholemount_possible.wlz
19292_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19292_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 16 17 20 21 22 weak expression: see section 02 03 04 05 06 07 08 09 10 11 12 15 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 weak expression: see section 05 06 07
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 14 15 16 17 18 19 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 14 15 16 17 18 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 17 18
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 01 02
left lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21
trachea
moderate moderate
regionalmoderate expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T726
Entity Detected:Npc2, Niemann Pick type C2 ( MGI:1915213)
Sequence:sense strand is shown

>T726
TCCTCGAGNCTGTTGGCCTACTGGCTTCCTAGATTGCAGAGCTTTCATATCCACGATGCGTTTTCTGGCC
GCCACGATCCTGCTGCTGGCGCTGGTCGCTGCCAGCCAGGCGGAGCCCCTGCACTTCAAGGACTGCGGCT
CTAAGGTGGGAGTTATAAAGGAGGTGAATGTGAGCCCATGTCCCACCGATCCCTGTCAGCTGCACAAAGG
CCAGTCCTACAGTGTCAACATCACCTTTACCAGCGGCACTCAGTCCCAGAACAGCACGGCCTTGGTCCAC
GGCATCCTGGAAGGGATCCGGGTCCCCTTCCCTATTCCTGAGCCTGACGGTTGTAAGAGTGGAATCAACT
GCCCCATCCAGAAAGACAAGGTCTACAGCTACCTGAATAAGCTTCCGGTGAAGAATGAATACCCCTCTAT
AAAACTGGTGGTGGAATGGAAACTTGAAGATGACAAAAAGAATAATCTCTTCTGCTGGGAGATCCCAGTT
CAGATCACAAGCTAGGCTCCTTGGCGCCTGTGTCTGTGTGGGCTGAGAGGCCATGGACG
Notes:The probe template was PCR amplified from IMAGE:1890275 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890275 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19293 same embryo
 EMAGE:19294 same embryo
 EMAGE:19290 same embryo
 EMAGE:19291 same embryo
 EurExpress:euxassay_001964 same experiment
 MGI:4826760 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS