Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8307

Nrk Nik related kinase ( MGI:1351326)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307
"Pseudo-wholemount" of euxassay_007626. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007626_01 euxassay_007626_02 euxassay_007626_03 euxassay_007626_04
EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307
euxassay_007626_05 euxassay_007626_06 euxassay_007626_07 euxassay_007626_08 euxassay_007626_09
EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307
euxassay_007626_10 euxassay_007626_11 euxassay_007626_12 euxassay_007626_13 euxassay_007626_14
EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307
euxassay_007626_15 euxassay_007626_16 euxassay_007626_17 euxassay_007626_18 euxassay_007626_19
EMAGE:8307 EMAGE:8307 EMAGE:8307 EMAGE:8307
euxassay_007626_20 euxassay_007626_21 euxassay_007626_22 euxassay_007626_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8307Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8307_wholemount_strong.wlz
8307_wholemount_moderate.wlz
8307_wholemount_weak.wlz
8307_wholemount_possible.wlz
8307_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8307_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 03 04 05 21 22 23
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22 23 moderate expression: see section 09 weak expression: see section 10 15 16
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
upper arm rest of mesenchyme
strong strong
regionalstrong expression: see section 02
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 10
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 10
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 10
foot mesenchyme
strong strong
regionalstrong expression: see section 09 20 21 22
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20 21
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 19 20 21 22 23
tongue
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16 17
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 12 14 15 weak expression: see section 13
clavicle
moderate moderate
regionalmoderate expression: see section 10 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36701
Entity Detected:Nrk, Nik related kinase ( MGI:1351326)
Sequence:sense strand is shown

>T36701
CATCTGTATCTGATGGACCGAAGTGGAAAGGCAGAAATTGTTAAACTTATAAAGCGAAGACCATTCCGGC
AGATTCAAGTCGTGGAGCAGCTCAATTTGCTGATTACCATCTCTGGCAAAAAGAACAGACTTCGCGTGTA
TCATCTGTCTTGGCTGAGGAACAAAATTCTGAATAATGATCCAAAGAGTAAGAAAAGGCAGAAGGCGATG
AGGAAGAAAGAGGAAGCTTGCAAAGCTATCGATAAGTTGATTGGCTGTGAACACTTCAGTGTCCTTCAAC
ATGAAGAAACAACATACATTGCGGTTGCTGTGAAGTCATCAATTCACCTCTTTGCATGGGCACCAAAATC
CTTTGATGAAAACACTGCCATTAAAGTGTTTCCAACTCGTGATCTTAAGCCACTGACAGTTGACCTGGCT
GTTGGTTCAGAGAAAACACTGAAGATTTTCTTCAGCTCAGCTAATGGATATCATATCATCGATGCAGAAT
CTGAAGTTATGTCTGAGGTGACCTTGCCAAATAATAATGTCGTCATTTTACCTGATTGCTTGGGACTTGG
TGTGATGCTCTCCCTCAATGCTGAAGCTGCCTCCGAGGAAGCAAACGAACAACTCCTTAAGAAGATCCTG
GACGTGTGGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74747. Forward Primer - name:074747_F_cDNA_Nrk, sequence:CATCTGTATCTGATGGACCGAA; Reverse Primer - name:074747_N_SP6_cDNA_Nrk, sequence:TTCCACACGTCCAGGATCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8309 same embryo
 EMAGE:8308 same embryo
 EMAGE:8311 same embryo
 EMAGE:8312 same embryo
 EMAGE:8310 same embryo
 EurExpress:euxassay_007626 same experiment
 MGI:4826794 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS