Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19740

Bcar3 breast cancer anti-estrogen resistance 3 ( MGI:1352501)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740
"Pseudo-wholemount" of euxassay_006211. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006211_01 euxassay_006211_02 euxassay_006211_03 euxassay_006211_04
EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740
euxassay_006211_05 euxassay_006211_06 euxassay_006211_07 euxassay_006211_08 euxassay_006211_09
EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740
euxassay_006211_10 euxassay_006211_11 euxassay_006211_12 euxassay_006211_13 euxassay_006211_14
EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740 EMAGE:19740
euxassay_006211_15 euxassay_006211_16 euxassay_006211_17 euxassay_006211_18 euxassay_006211_19
EMAGE:19740 EMAGE:19740 EMAGE:19740
euxassay_006211_20 euxassay_006211_21 euxassay_006211_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19740Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19740_wholemount_strong.wlz
19740_wholemount_moderate.wlz
19740_wholemount_weak.wlz
19740_wholemount_possible.wlz
19740_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19740_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 06 07 13 14 15 16
adenohypophysis
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
thalamus mantle layer
weak weak
regionalweak expression: see section 08 09 10 15 16 17
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 06 07 08 09 10 11 12 13 14
tongue epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T542
Entity Detected:Bcar3, breast cancer anti-estrogen resistance 3 ( MGI:1352501)
Sequence:sense strand is shown

>T542
TCTCGAGNCTGTTGGCCTACTGGAGTAAGGAATAGGTTGAGCTACACTTGAAGTCTAGCTTCTCGGGGGA
AGATAAGGGGGAGTCAAAACTCTCAAATCCGGGCGGAGGAGAGCCAGACGAGGTCACCGAATGTAAAAGT
CGCCGGGGTTCGGCTCAGCCCGGCGAATCGGCTGGGCGGGGTGGGGCCGCGAAGCCGCAAATCACCAGTT
GAGGGCCAGAGAGCGCGCTGCCGGCTCAGAGCTGAGCCTGCAGCCGCCGGGCCAGGCAGCAGCCGGAGCG
GGACAGCCGTGCACACCCGCCAGCCGCACCAGCCTCTTGGCGGACGCCCGCGGACCATGAGCCGCCCGAG
CTCCGAGAGCAGCTGCGGTGAGGTGAGAGCAGCCCGGCGCTGAACCGCAACCCCGGACCCCGAACGCGGC
GCGGGGAGAGTTAAGAATCATGGCTGCGGGAAAGTTTGCAAGCCTTCCCAGAAACATGCCTGTGAATCAC
CAGTTCCCCTTGGCCTCGTCCATGGACCTCCTGAGCAGCAAGTCCCCTCTTGCTGAGCGTCGCACAGATG
CCTATC
Notes:The probe template was PCR amplified from IMAGE:1498921 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1498921 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19739 same embryo
 EMAGE:19741 same embryo
 EMAGE:19743 same embryo
 EMAGE:19742 same embryo
 EMAGE:19738 same embryo
 EurExpress:euxassay_006211 same experiment
 MGI:4823439 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS