Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7774

Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 ( MGI:108405)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774
"Pseudo-wholemount" of euxassay_007659. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007659_01 euxassay_007659_02 euxassay_007659_03 euxassay_007659_04
EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774
euxassay_007659_05 euxassay_007659_06 euxassay_007659_07 euxassay_007659_08 euxassay_007659_09
EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774
euxassay_007659_10 euxassay_007659_11 euxassay_007659_12 euxassay_007659_13 euxassay_007659_14
EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774
euxassay_007659_15 euxassay_007659_16 euxassay_007659_17 euxassay_007659_18 euxassay_007659_19
EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774 EMAGE:7774
euxassay_007659_20 euxassay_007659_21 euxassay_007659_22 euxassay_007659_23 euxassay_007659_24
EMAGE:7774
euxassay_007659_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7774Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7774_wholemount_strong.wlz
7774_wholemount_moderate.wlz
7774_wholemount_weak.wlz
7774_wholemount_possible.wlz
7774_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7774_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 14 weak expression: see section 12 13 15
thalamus mantle layer
weak weak
regionalweak expression: see section 10 11 12 14 15
corpus striatum
moderate moderate
regionalmoderate expression: see section 04 05 06 07 18 19 20 21
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 14 15 weak expression: see section 08 11
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 09 10 11 12 13 14 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11 12 13
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
nasal septum
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 13 14
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35938
Entity Detected:Apbb2, amyloid beta (A4) precursor protein-binding, family B, member 2 ( MGI:108405)
Sequence:sense strand is shown

>T35938
AGAGAGGGACTTTGCTTACGTGGCGAGAGACAAGGACACAAGGATTCTGAAATGCCATGTGTTTCGATGT
GACACACCAGCAAAAGCCATTGCCACAAGTCTCCACGAAATCTGCTCCAAGATTATGGCTGAACGGAAGA
ACGCCAAAGCACTGGCCTGCAGCTCCTTACAGGAGAGGACCAATATGAGTCTCGATGTCCCTTTGCAAGT
AGATTTTCCAACACCAAAGACGGAGCTGGTGCAGAAGTTCCGCGTGCAGTACCTGGGCATGTTACCTGTA
GACAGACCTGTCGGCATGGACACCCTGAACAGTGCCATAGAAAATCTCATGACGTCATCCAGCAAGGAGG
ACTGGCCTTCGGTGAACATGAACGTGGCCGACGCCACTGTGACTGTCATCAGTGAAAAGAATGAAGAGGA
GGTCTTGGTGGAGTGTCGAGTGCGGTTCCTGTCCTTCATGGGTGTCGGGAAGGATGTCCACACATTCGCC
TTCATCATGGACACTGGGAACCAGCGCTTTGAGTGCCATGTGTTCTGGTGTGAGCCTAACGCAGCCAATG
TGTCAGAAGCTGTCCAGGCTGCCTGCATGTTGCGGTATCAGAAGTGCTTGGTTGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64005. Forward Primer - name:064005_F_cDNA_Apbb2, sequence:AGAGAGGGACTTTGCTTACGTG; Reverse Primer - name:064005_N_SP6_cDNA_Apbb2, sequence:TGGCAACCAAGCACTTCTGATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7770 same embryo
 EMAGE:7773 same embryo
 EMAGE:7769 same embryo
 EMAGE:7772 same embryo
 EMAGE:7771 same embryo
 EurExpress:euxassay_007659 same experiment
 MGI:4823171 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS