Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7892

Casz1 castor homolog 1, zinc finger (Drosophila) ( MGI:1196251)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892
"Pseudo-wholemount" of euxassay_012815. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012815_01 euxassay_012815_02 euxassay_012815_03 euxassay_012815_04
EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892
euxassay_012815_05 euxassay_012815_06 euxassay_012815_07 euxassay_012815_08 euxassay_012815_09
EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892
euxassay_012815_10 euxassay_012815_11 euxassay_012815_12 euxassay_012815_13 euxassay_012815_14
EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892
euxassay_012815_15 euxassay_012815_16 euxassay_012815_17 euxassay_012815_18 euxassay_012815_19
EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892 EMAGE:7892
euxassay_012815_20 euxassay_012815_21 euxassay_012815_22 euxassay_012815_23 euxassay_012815_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7892Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7892_wholemount_strong.wlz
7892_wholemount_moderate.wlz
7892_wholemount_weak.wlz
7892_wholemount_possible.wlz
7892_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7892_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 19 20 weak expression: see section 06
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 15 16 weak expression: see section 08
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 19 21 weak expression: see section 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 09 17 18 19 20 21 weak expression: see section 05 06 07 08
vagus x ganglion
weak weak
regionalweak expression: see section 07 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15 weak expression: see section 13 16
lower jaw incisor
weak weak
regionalweak expression: see section 15 16
lower jaw molar
weak weak
regionalweak expression: see section 07 08 18
upper jaw incisor
weak weak
regionalweak expression: see section 15 16
upper jaw molar
weak weak
regionalweak expression: see section 07 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38200
Entity Detected:Casz1, castor homolog 1, zinc finger (Drosophila) ( MGI:1196251)
Sequence:sense strand is shown

>T38200
CGAGGAATACATCCGTAAGCTCAAGGCCGGCGAGCAACTTCCCTGGCCAGCCCACGGGAGCAAAGCCGAG
GACCGGGCAGGCAAGGAGGTGGTGGGTCCCTTACCCAGCCTACGGCTGCCCAGCAACACGGCCCACCTGG
AAACCAAGGCCACCATCCTGCCACTGCCATCACACAGCAGTGTCCAGATGCAGAATCTGGTAGCTCGTGC
TTCCAAGTATGACTTCTTCATCCACAAACTGAAGACAGGCGAGAACCTGAGGCCCCAGAATGGAAGCACT
TACAAGAAGCCATCCAAGTATGACCTGGAGAATGTCAAGTACTTGCACCTCTTCAAACCCGGGGAAGGCA
GCCCTGACATGGGCGGGGCCATCGCCTTCAAGACAGGCAAGGTGGGGCGCCCCTCTAAGTACGACGTTCG
GGGCATCCAGAAGCCAGGCCCTACCAAGATTCCGCCCGCCCCCAGCCTGGTTCCTACACCCCTCACCAAT
GTGCCCAGTGCTCCCAGCACCCCCGGACCAGGACCGGAGCCACCTGCCTCCTTGTCCTTCAACACTCCCG
AGTACCTGAAGTCAACCTTTTCCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103682. Forward Primer - name:103682_F_cDNA_D4Ertd432e, sequence:CGAGGAATACATCCGTAAGCTC; Reverse Primer - name:103682_N_SP6_cDNA_D4Ertd432e, sequence:TTGGAAAAGGTTGACTTCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7888 same embryo
 EMAGE:7890 same embryo
 EMAGE:7891 same embryo
 EMAGE:7889 same embryo
 EurExpress:euxassay_012815 same experiment
 MGI:4823648 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS