Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10120

1110034A24Rik RIKEN cDNA 1110034A24 gene ( MGI:1923566)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120
"Pseudo-wholemount" of euxassay_000104. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000104_01 euxassay_000104_02 euxassay_000104_03 euxassay_000104_04
EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120
euxassay_000104_05 euxassay_000104_06 euxassay_000104_07 euxassay_000104_08 euxassay_000104_09
EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120
euxassay_000104_10 euxassay_000104_11 euxassay_000104_12 euxassay_000104_13 euxassay_000104_14
EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120
euxassay_000104_15 euxassay_000104_16 euxassay_000104_17 euxassay_000104_18 euxassay_000104_19
EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120 EMAGE:10120
euxassay_000104_20 euxassay_000104_21 euxassay_000104_22 euxassay_000104_23 euxassay_000104_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10120Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10120_wholemount_strong.wlz
10120_wholemount_moderate.wlz
10120_wholemount_weak.wlz
10120_wholemount_possible.wlz
10120_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10120_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 19 weak expression: see section 10 18
vibrissa
moderate moderate
spottedmoderate expression: see section 24 weak expression: see section 08 10
cerebral cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23
midbrain lateral wall
moderate moderate
homogeneousmoderate expression: see section 08 09 weak expression: see section 14
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 11 12 13
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13
inner ear
weak weak
regionalweak expression: see section 20
labyrinth
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 20 22
otic capsule
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 05 08 09 22 not detected expression: see section 07
nasal cavity
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 13 14 15 16 17 19
nasal septum
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 14 16 17
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
lower jaw
weak weak
regionalweak expression: see section 11 12 20 22 23
oral epithelium
weak weak
regionalweak expression: see section 12
liver
moderate moderate
spottedmoderate expression: see section 12 weak expression: see section 01 02 03 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 22 23 24
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 11 18 19 20
metanephros
weak weak
regionalweak expression: see section 08 09
frontal bone primordium
moderate moderate
homogeneousmoderate expression: see section 23 24 weak expression: see section 01 02 03 04 05 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1566
Entity Detected:1110034A24Rik, RIKEN cDNA 1110034A24 gene ( MGI:1923566)
Sequence:sense strand is shown

>T1566
TTTTTTTTTTTTTTAGGTCCCAATTTTTTTTACTCAATTTTTAAATTTCAAAATCATATACATCAGTCTA
AATCATATAGCAAGGGATTCTGAAAACTGAATGCACAATGAGTCGTGTGGTCTCTAATAATCTGCACACT
ACCATCCTGCATATTCGTCTCTTTTATAGTGTCAAAGTCAGGTATGTTTTGAACCACAGTTTTGTTCAGT
AATGAAGATGGGTGATCTCCATTTATTTTTTCCCCCTTGCTTATTACTGGCTCTCTTATATTTTCCTTTT
CCTCAGTCGAGTAGGTAGTACTACTTTCTCTTATAAACTCAGGATCCATTTTTGCCTCTGGTTGCAGCGG
TTTTCCAGACAGTACGTGAGGAACCTCAGGACAGCCGTGTTGCAGGTCCACAGCTGAACCATGCGTGTTT
ATTTTTAGTGCTTCGACTGCTGCAGCTGAATCAGAAGCAGCTGGAGAGGTGGCGGACTGGTCAGCGGCTT
CTGCTTCA
Notes:The probe template was PCR amplified from IMAGE:907534 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:907534 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10122 same embryo
 EMAGE:10119 same embryo
 EMAGE:10117 same embryo
 EMAGE:10121 same embryo
 EMAGE:10118 same embryo
 EurExpress:euxassay_000104 same experiment
 MGI:4822594 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS