Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11530

Mrpl20 mitochondrial ribosomal protein L20 ( MGI:2137221)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530
"Pseudo-wholemount" of euxassay_006751. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006751_01 euxassay_006751_02 euxassay_006751_03 euxassay_006751_04
EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530
euxassay_006751_05 euxassay_006751_06 euxassay_006751_07 euxassay_006751_08 euxassay_006751_09
EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530
euxassay_006751_10 euxassay_006751_11 euxassay_006751_12 euxassay_006751_13 euxassay_006751_14
EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530 EMAGE:11530
euxassay_006751_15 euxassay_006751_16 euxassay_006751_17 euxassay_006751_18 euxassay_006751_19
EMAGE:11530 EMAGE:11530 EMAGE:11530
euxassay_006751_20 euxassay_006751_21 euxassay_006751_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11530Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11530_wholemount_strong.wlz
11530_wholemount_moderate.wlz
11530_wholemount_weak.wlz
11530_wholemount_possible.wlz
11530_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11530_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21 22
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 19
pancreas
weak weak
regionalweak expression: see section 10 11 12 16
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 05 09 10 19 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 19 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 09 17
trigeminal v nerve
weak weak
regionalweak expression: see section 10
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 11
cervical ganglion
weak weak
regionalweak expression: see section 10
thoracic ganglion
weak weak
regionalweak expression: see section 15
dorsal root ganglion
weak weak
regionalweak expression: see section 10 11 12 13 14 17 18
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 weak expression: see section 12
lower jaw molar
weak weak
regionalweak expression: see section 07 08 17 18 19
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 10 17 18 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 weak expression: see section 12
upper jaw molar
weak weak
regionalweak expression: see section 07 08 17 18 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 13 14 15 17 weak expression: see section 10 11 12 16 18 19 20 21 22
bladder
weak weak
regionalweak expression: see section 13 14 15 16
metanephros
weak weak
regionalweak expression: see section 08 09 10 11 12 17 18 19 20 21
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 05 06 20 21 22 weak expression: see section 02 03 04
clavicle
weak weak
regionalweak expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8222
Entity Detected:Mrpl20, mitochondrial ribosomal protein L20 ( MGI:2137221)
Sequence:sense strand is shown

>T8222
AGCCCATCATGGTCTTCCTCACGACGCGGCTCTGGCTGCGGAACCGCCTCACCGATCGCTATTGGCGGGT
TCAGGAGGTGCTGAAACACGCTCAGCATTTTCGGGGAAGGAAGAATCGCTGCTACCGCCTGGCCGTCAGG
GCGGTGACCAGAGCCTTCGTTAAGTGTACGAAGGCCCGCAGACTTAAGAAGCGGAACCTGAGGACCCTCT
GGATTAATCGAATTACAGCTGCCTCCCAGGAACATGGCTTAAAGTACCCAGCATTCATTGTCAACTTAAT
TAAGTGCCAGGTGGAGCTCAACAGGAAAGTTCTTGTGGACCTGGCCATCTATGAACCAAAGACGTTTAAA
TCTTTGGCTGCATTGGCTAAGCGGAGGCAGCAGGAGGGATTTGCTGCAGCTTTGGGGGATGGAAAGGAGC
CTGAAGGTATCTTTTCCAGAGTGGTGCAGTACCACTGAAGGCTGCAGTGCTATAGACTGTTATAAACAAG
ATAGGACCAAAAGGACTGTCACCAGTAAGTCTGATTTGTATTTATTTACATTTTAGCAACAGGCCTGAGA
CGACAGGTCTTTATTCAGTGACACGGCCCCAAACTGTCCTGTAAAGATTGTATAAATAAAGCCTTTGCAG
TGTTGAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1244957 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1244957 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11534 same embryo
 EMAGE:11531 same embryo
 EMAGE:11533 same embryo
 EMAGE:11529 same embryo
 EMAGE:11532 same embryo
 EurExpress:euxassay_006751 same experiment
 MGI:4826443 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS