Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18215

Pla2g7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) ( MGI:1351327)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215
"Pseudo-wholemount" of euxassay_011999. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011999_01 euxassay_011999_02 euxassay_011999_03 euxassay_011999_04
EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215
euxassay_011999_05 euxassay_011999_06 euxassay_011999_07 euxassay_011999_08 euxassay_011999_09
EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215
euxassay_011999_10 euxassay_011999_11 euxassay_011999_12 euxassay_011999_13 euxassay_011999_14
EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215
euxassay_011999_15 euxassay_011999_16 euxassay_011999_17 euxassay_011999_18 euxassay_011999_19
EMAGE:18215 EMAGE:18215 EMAGE:18215 EMAGE:18215
euxassay_011999_20 euxassay_011999_21 euxassay_011999_22 euxassay_011999_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18215Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18215_wholemount_strong.wlz
18215_wholemount_moderate.wlz
18215_wholemount_weak.wlz
18215_wholemount_possible.wlz
18215_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18215_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 17
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 08 09 10 11 moderate expression: see section 04 05 06 07 12 14 15
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 03 05 06 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 16 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16
lens
strong strong
regionalstrong expression: see section 01 02 weak expression: see section 23
neural retina
weak weak
regionalweak expression: see section 03 22
anterior naris epithelium
strong strong
regionalstrong expression: see section 15
posterior naris epithelium
strong strong
regionalstrong expression: see section 15
nasal cavity
strong strong
regionalstrong expression: see section 11 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 14 16 17 18
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 15
nasal septum
strong strong
regionalstrong expression: see section 13
stomach
moderate moderate
regionalmoderate expression: see section 04 05 06 07
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 13
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30084
Entity Detected:Pla2g7, phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) ( MGI:1351327)
Sequence:sense strand is shown

>T30084
AAGGTCGCCTCGACACTGTTTGGATCCCAAACAAAGAATATTTTTTGGGTCTTAGTATATTTCTTGGAAC
ACCCAGTATTGTAGGCAATATTTTACACCTCTTATATGGTTCTCTGACAACTCCTGCAAGCTGGAATTCT
CCTTTGAGGACTGGAGAAAAATACCCGCTCATTGTCTTTTCTCATGGTCTCGGAGCCTTCAGGACGATTT
ATTCTGCTATTGGCATTGGCCTGGCATCTAATGGGTTTATAGTGGCCACTGTCGAACACAGAGACAGATC
TGCATCGGCAACTTACTTTTTTGAAGACCAGGTGGCTGCAAAAGTGGAAAACAGGTCTTGGCTTTACCTG
AGAAAAGTAAAACAAGAGGAGTCGGAAAGTGTCCGGAAAGAACAGGTTCAGCAAAGAGCAATAGAATGTT
CCCGGGCTCTCAGTGCGATTCTTGACATTGAACATGGAGACCCAAAAGAGAATGTACTAGGTTCAGCTTT
TGACATGAAACAGCTGAAGGATGCTATTGATGAGACTAAAATAGCTTTGATGGGACATTCTTTTGGAGGA
GCAACAGTTCTTCAAGCCCTTAGTGAGGACCAGAGATTCAGATGTGGAGTTGCTCTTGATCCATGGATGT
ATCCGGTGAACGAAGAGCTGTACTCCAGAACCCTCCAGCCTCTCCTCTTTATCAACTCTGCCAAATTCCA
GACTCCAAAGGACATCGCAAAAATGAAAAAGTTCTACCAGCCTGACAAGGAAAGGAAAATGATTACAATC
AAGGGCTCAGTGCACCAGAACTTTGACGACTTTACTTTTGTAACTGGCAAAATAATTGGAAACAAGCTGA
CACTGAAAGGAGAAATCGATTCCAGAGTAGCCATCGACCTCACCAACAAAGCTTCGATGGCTTTCTTACA
AAAGCATTTAGGGCTTCAGAAAGACTTTGATCAGTGGGACCCTCTGGTGGAAGGAGATGATGAGAACCTG
ATTCCTGGGTCACCCTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3707891), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 8999. Forward Primer - name:008999_F_IRAV20-23_I18_Pla2g7, sequence:AAGGTCGCCTCGACACTG; Reverse Primer - name:008999_R_SP6_IRAV20-23_I18_Pla2g7, sequence:TCAAAGGGTGACCCAGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18217 same embryo
 EMAGE:18218 same embryo
 EMAGE:18220 same embryo
 EMAGE:18219 same embryo
 EMAGE:18216 same embryo
 EurExpress:euxassay_011999 same experiment
 MGI:4827244 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS