Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20267

Hsd11b2 hydroxysteroid 11-beta dehydrogenase 2 ( MGI:104720)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267
"Pseudo-wholemount" of euxassay_012410. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012410_01 euxassay_012410_02 euxassay_012410_03 euxassay_012410_04
EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267
euxassay_012410_05 euxassay_012410_06 euxassay_012410_07 euxassay_012410_08 euxassay_012410_09
EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267
euxassay_012410_10 euxassay_012410_11 euxassay_012410_12 euxassay_012410_13 euxassay_012410_14
EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267 EMAGE:20267
euxassay_012410_15 euxassay_012410_16 euxassay_012410_17 euxassay_012410_18 euxassay_012410_19
EMAGE:20267 EMAGE:20267
euxassay_012410_20 euxassay_012410_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20267Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20267_wholemount_strong.wlz
20267_wholemount_moderate.wlz
20267_wholemount_weak.wlz
20267_wholemount_possible.wlz
20267_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20267_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 09 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 17 weak expression: see section 07 09 15 16
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15 16 17
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 03 09 10 11 12 13 14 15 16 18 19 moderate expression: see section 04 05 06 07 08 17
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 03 04 05 06 07 08 17 18
pons ventricular layer
weak weak
regionalweak expression: see section 06 07 08 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 weak expression: see section 09 15
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12
cochlea
moderate moderate
regionalmoderate expression: see section 06 07 08 15 weak expression: see section 04 05 16 17 18 19
ureter
weak weak
regionalweak expression: see section 06 07 08 13 14 15
metanephros
moderate moderate
regionalmoderate expression: see section 08 09 14 15 16 17 weak expression: see section 06 07
male reproductive system
weak weak
regionalweak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31288
Entity Detected:Hsd11b2, hydroxysteroid 11-beta dehydrogenase 2 ( MGI:104720)
Sequence:sense strand is shown

>T31288
GAATAGCCCTGGTGCCCTAGAACTGCGTGACCTCTGTTCTCCTCGCCTGAAGCTGCTGCAGATGGATCTG
ACCAAGGCAGAGGACATCAGCCGTGTTCTGGAAATCACCAAGGCCCACACGGCCAGCACTGGCCTGTGGG
GTCTGGTTAACAACGCTGGCCTCAATATCGTAGTGGCTGACGTGGAACTGTCTCCAGTGGCGACTTTCCG
CAAGTGCATGGAGGTGAACTTCTTTGGTGCACTTGAGCTGACCAAGGGCCTCCTGCCACTCTTGCGTCAC
TCGAGGGGACGTATTGTGACCGTTGGCAGCCCAGCAGGAGACATGCCATACCCCTGCTTGGCAGCCTACG
GCACCTCCAAGGCAGCAATAGCACTGCTTATGGACACATTCGGCTGTGAGCTGCTTCCCTGGGGTATCAA
GGTCAGCATTATCAAGCCTGGCTGCTTCAAGACAGATGCAGTGACTAATGTGAACCTCTGGGAGAAACGC
AAGCAACTGCTGCTGGCCAACATTCCTAGAGAGCTGCTCCAGGCCTATGGTGAAGACTACATTGAGCACG
TGCACGGGCAGTTCCTGAATTCACTCAGAATGGCATTGCCTGACCTTAGCCCAGTTGTAGATGCCATCAT
CGATGCATTGCTGGCAGCTCAGCCACGAAGCCGCTACTACCCAGGCCGTGGCCTGGGGCTCATGTATTTC
ATCCACCACTACCTGCCAGAGGGCCTGCGACGCTGCTTCCTACAGAACTTCTTTATCAATCACCTTCTGC
CCCGAGCACTGAGGCCCGGCCAACATGGCCCTGCTCCTGCTTAAGACACACCCTTCCCCAGTGGCAGCTC
TGTGAGCCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4235545), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54993. Forward Primer - name:054993_F_IRAV50_g08_Hsd11b2, sequence:GAATAGCCCTGGTGCCCT; Reverse Primer - name:054993_R_SP6_IRAV50_g08_Hsd11b2, sequence:TGTGGCTCACAGAGCTGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20266 same embryo
 EMAGE:20268 same embryo
 EMAGE:20269 same embryo
 EMAGE:20265 same embryo
 EurExpress:euxassay_012410 same experiment
 MGI:4825460 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS