Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20724

Crim1 cysteine rich transmembrane BMP regulator 1 (chordin like) ( MGI:1354756)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724
"Pseudo-wholemount" of euxassay_014038. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014038_01 euxassay_014038_02 euxassay_014038_03 euxassay_014038_04
EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724
euxassay_014038_05 euxassay_014038_06 euxassay_014038_07 euxassay_014038_08 euxassay_014038_09
EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724
euxassay_014038_10 euxassay_014038_11 euxassay_014038_12 euxassay_014038_13 euxassay_014038_14
EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724 EMAGE:20724
euxassay_014038_15 euxassay_014038_16 euxassay_014038_17 euxassay_014038_18 euxassay_014038_19
EMAGE:20724 EMAGE:20724 EMAGE:20724
euxassay_014038_20 euxassay_014038_21 euxassay_014038_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20724_wholemount_strong.wlz
20724_wholemount_moderate.wlz
20724_wholemount_weak.wlz
20724_wholemount_possible.wlz
20724_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20724_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
physiological umbilical hernia
moderate moderate
regionalmoderate expression: see section 13
vibrissa
moderate moderate
regionalmoderate expression: see section 21 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 13 15 17 weak expression: see section 08 09 10
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 17 weak expression: see section 07 08 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 09 17 weak expression: see section 08
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
lens
strong strong
regionalstrong expression: see section 01 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40116
Entity Detected:Crim1, cysteine rich transmembrane BMP regulator 1 (chordin like) ( MGI:1354756)
Sequence:sense strand is shown

>T40116
TTTCTATAGAGTCACAGCCGCAGTAGGCAGTGAGGAAGCCAGGGAGATGGAAAGCAACAGTTCTCGAAAG
CGGGTTCTTGAGGATGTATTCACTTTTTTTGCTGCTGCTGTTTTCTTCCGTGCCAACCAGCCAGTTCCTA
GGAGACACAGCAGGTTGAGTAGGAACGAGGTCACCTCTTGACCTGACCACTGGAGCTTTGCTCGCTACGT
GACAGGAAGGGCAACGGCGAAGGACACCAGGCATTTCCAGGGGCTACACTTCATTGTTCCTTGTTGTTTT
CTTCTGTGCTATCATTGGTTGTTCATAGTTTTGTTAAAGCTCTAGCTTAAGAAGAAACTTTTGAGAAAAA
GAAAAAAAAGGACTGTTTGGGATTTTTTTTCCTTATTATATACTGATTCTACAAAATAGAAACTACTTCA
TTTTAATTGTATATTATTCAAGCACCTTTGTTGAAACTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85556. Forward Primer - name:085556_F_cDNA_Crim1, sequence:TTTCTATAGAGTCACAGCCGCA; Reverse Primer - name:085556_N_SP6_cDNA_Crim1, sequence:GAGTTTCAACAAAGGTGCTTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20721 same embryo
 EMAGE:20720 same embryo
 EMAGE:20725 same embryo
 EMAGE:20722 same embryo
 EMAGE:20723 same embryo
 EurExpress:euxassay_014038 same experiment
 MGI:4824053 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS