Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30910

Vcan versican ( MGI:102889)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910
euxassay_010952_01 euxassay_010952_02 euxassay_010952_03 euxassay_010952_04 euxassay_010952_05
EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910
euxassay_010952_06 euxassay_010952_07 euxassay_010952_08 euxassay_010952_09 euxassay_010952_10
EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910
euxassay_010952_11 euxassay_010952_12 euxassay_010952_13 euxassay_010952_14 euxassay_010952_15
EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910 EMAGE:30910
euxassay_010952_16 euxassay_010952_17 euxassay_010952_18 euxassay_010952_19 euxassay_010952_20
EMAGE:30910
euxassay_010952_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 06 07 21
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02 03
metanephros
strong strong
regionalstrong expression: see section 06 07 08 09 10 16 17 18 19
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 21
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 13 15
male reproductive system
strong strong
regionalstrong expression: see section 11 12 13 14 15
axial skeleton
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 10 11 12
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12 15
tarsus
strong strong
regionalstrong expression: see section 03 04 05 06
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 13 14 15 16 moderate expression: see section 08
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 03 05 06 13 14 15 16 18 19
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 02 03
bladder
strong strong
regionalstrong expression: see section 12 13 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 11 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 17
trachea
strong strong
regionalstrong expression: see section 11 12 13
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 20 moderate expression: see section 19
upper lip
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 moderate expression: see section 08 17
heart valve
strong strong
regionalstrong expression: see section 09 10 11 12 13
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 moderate expression: see section 05 17
lower lip
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 moderate expression: see section 08 17
mandible
moderate moderate
regionalmoderate expression: see section 06 07
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 08
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21
stomach
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 01 02 weak expression: see section 03 04
palatal shelf
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15
pons ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 04 05 10
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 17
midgut
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 11 12 13 14 15 16 17 18
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 11 12 13 moderate expression: see section 08 09 10
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 09 10 11 12 13 14 15 moderate expression: see section 08
physiological umbilical hernia
strong strong
regionalstrong expression: see section 13 14
maxilla
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 18
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 06 07 08 09 10 12 13 14 15 16
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15 16
lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36208
Entity Detected:Vcan, versican ( MGI:102889)
Sequence:sense strand is shown

>T36208
CAAACCTGAGACTTCCCAAGACTTCCCAAACAAAGCAAAGGATCACATTCCAGGAGAAACAGTTGGGATG
CTTGCTGGTATCAGAACAACAGAGAGCGAACCTGTCATTACTGCAGACGACATGGAGCTAGGAGGTGCCA
CACAGCAGCCACATTCTGCTTCTGCAGCTTTCAGAGTTGAGACAGGTATGGTACCTCAGCCCATCCAACA
GGAGCCTGAGAGGCCAACCTTTCCTTCCTTGGAAATTAACCATGAAACACACACATCATTATTTGGAGAA
TCTATACTGGCAACATCTGAAAAACAAGTGTCTCAAAAAATTCTTGATAATAGTAACCAGGCAACAGTCA
GTAGTACTCTGGATCTACATACTGCACATGCATTATCACCATTTTCCATTCTGGACAATTCTAATGAAAC
TGCTTTCCTGATTGGCATTAGTGAAGAGTCCGTGGAAGGCACAGCAGTTTACCTACCAGGACCTGATCTC
TGCAAAACAAACCCATGCCTCAACGGAGGCACCTGTTATCCTACCGAGACTTCCTATGTGTGCACCTGTG
CACCTGGATACAGCGGAGACCAGTGTGAACTTGATTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84266. Forward Primer - name:084266_F_cDNA_Cspg2, sequence:CAAACCTGAGACTTCCCAAGAC; Reverse Primer - name:084266_N_SP6_cDNA_Cspg2, sequence:AAATCAAGTTCACACTGGTCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010952 same experiment
 EMAGE:31081 same embryo
 EMAGE:31096 same embryo
 EMAGE:30919 same embryo
 EMAGE:30832 same embryo
 EMAGE:29339 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS