Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31081

Disp2 ( MGI:2388733)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081
euxassay_009571_01 euxassay_009571_02 euxassay_009571_03 euxassay_009571_04 euxassay_009571_05
EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081
euxassay_009571_06 euxassay_009571_07 euxassay_009571_08 euxassay_009571_09 euxassay_009571_10
EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081
euxassay_009571_11 euxassay_009571_12 euxassay_009571_13 euxassay_009571_14 euxassay_009571_15
EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081 EMAGE:31081
euxassay_009571_16 euxassay_009571_17 euxassay_009571_18 euxassay_009571_19 euxassay_009571_20
EMAGE:31081 EMAGE:31081 EMAGE:31081
euxassay_009571_21 euxassay_009571_22 euxassay_009571_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 06 07 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 14 15
tongue
moderate moderate
spottedmoderate expression: see section 11
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 moderate expression: see section 16
thoracic ganglion
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 10 11 12 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 15 weak expression: see section 12 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 17 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 16 moderate expression: see section 05
trigeminal v ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 02 03 04 05 06 08 16 17 18 19 20 21
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15 16
adrenal medulla
moderate moderate
regionalmoderate expression: see section 07 08 09 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36286
Entity Detected:Disp2, ( MGI:2388733)
Sequence:sense strand is shown

>T36286
GAATGTTCCCCTGTAAGTGAGCAGTAGTTACCCCTTACCATTGCCACACCTGCCAGTCTTCTTGGACCTT
TGCAAAGTTACTCCACAGTGGCCTGCAGTTGGTCAAGACACTGAGAATGGTTGATTGATTGTCCCCCAAA
GTCATGTCACTGGGTAGCAGCAGGATTCTCTCCTGACTCATGCTGCCACTATAGCTCCCTGTCTCCTCCT
GAGTGTGAGCTTCAGGGCCCTGGGCCCCTGGCTGTCTTGGTCCTTTGCTTCTGGCAGTTACCCAGTCTCT
TTGCTTGAGCCTCTCTTTGTGAGCCCTCCCTCCCCTTGGGGCCTCCACCTCCAGAAAGAGTTGTAGTCTG
AGTAGACCGGAGAGTTCCTCATTTCCTTTGAGTTTCCCCGCTCTGAAACTCTCTGAGATGCCTACTAGCC
ATGGGCCTACCGGGTCACAGGCAGCCGAGCTGAAGCTTAGGCTTCAAGGATGTGCCTCTTTCATGGCTGA
GGAGTACAGACAGGCTTTGCCAGAAGAGGTACGAAGGGACAGAAGAATGTGAACAGAATCTAGTTAAGAC
AAGAACACAAAGTTGCTCTTGTGGAGTTGTCCAGGACCCTGAAGTCTAGGTATCAGGTCCTCAGTTTCTG
AAGACTAGGCCTCCCAGTAAGGTTGCTTGACGGTGTCACTGATCAGTGGCAGAGTGCTCTCCTGACTCAT
CCTGCCACTATGGCTCCCTGTCTCCTCCTGACCAACTGCCTGCTTCAGGGCCATTAGCTTTCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93094. Forward Primer - name:093094_F_cDNA_Disp2, sequence:GAATGTTCCCCTGTAAGTGAGC; Reverse Primer - name:093094_N_SP6_cDNA_Disp2, sequence:GAGAAAGCTAATGGCCCTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009571 same experiment
 EMAGE:30910 same embryo
 EMAGE:31096 same embryo
 EMAGE:30919 same embryo
 EMAGE:30832 same embryo
 EMAGE:29339 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS