Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31507

Laptm4b ( MGI:1890494)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507
euxassay_001940_01 euxassay_001940_02 euxassay_001940_03 euxassay_001940_04 euxassay_001940_05
EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507
euxassay_001940_06 euxassay_001940_07 euxassay_001940_08 euxassay_001940_09 euxassay_001940_10
EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507
euxassay_001940_11 euxassay_001940_12 euxassay_001940_13 euxassay_001940_14 euxassay_001940_15
EMAGE:31507 EMAGE:31507 EMAGE:31507 EMAGE:31507
euxassay_001940_16 euxassay_001940_17 euxassay_001940_18 euxassay_001940_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 03 04 10 11 moderate expression: see section 05 06 07 12 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 06 12 13 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 10 11 12
metencephalon basal plate
strong strong
regionalstrong expression: see section 04 05 06 07 11 12 13 14 15
ventral grey horn
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 12 13
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 14 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 15
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 13 14 15 16 17 moderate expression: see section 02 03 04 05 06 07 08 09 10 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T685
Entity Detected:Laptm4b, ( MGI:1890494)
Sequence:sense strand is shown

>T685
TCCTCGAGNCTGTTGGCCTACTGGAATGTCCGTGAATCCTACCTGTTTGGTCCTTATTATTCTTCTGTTT
ATCGGCATTCTTTCGACACTTAAGGGCTACTTGATTAGCTGCGTTTGGAGCTGCTACAGGTACATCAACG
GCAGGAACTCCTCCGATGTCCTGGTGTATGTTACCAGCAATGATACCACAGTGCTGCTGCCTCCGTACGA
TGATGCTACTGCTGTGCCTAGCACTGCCAAGGAACCACCACCACCTTACGTGTCCGCCTGAACCTGGTGC
GGAAGAGCTGAGAGCAGCAGTTTGAGCCCTTAGCTGCATGAATTATCCTGTGGTTTCACTTCCATGATGA
ACTCTCTGAGCCACATTTTACAATTTAGATGTTAAGCTGAAGCCTCTGTTGACACATGCCCTGTAGCTAA
GCACTGACTAGCGAGGCTGTAGGAGTGGAGTGTGGTGAGTTCCCAGAGTCTTTCTCAAAACTACAGACGT
TGGTCCCCGGGCTGGCTTATACCTGCCTGGCCCCAGAGCTGGGTGGGCAGTCATACTTTT
Notes:The probe template was PCR amplified from IMAGE:1888817 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888817 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001940 same experiment
 EMAGE:31826 same embryo
 EMAGE:31837 same embryo
 EMAGE:30603 same embryo
 EMAGE:31763 same embryo
 EMAGE:30599 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS