Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31998

Agc1 ( MGI:99602)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998
euxassay_000376_21 euxassay_000376_01 euxassay_000376_02 euxassay_000376_03 euxassay_000376_04
EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998
euxassay_000376_05 euxassay_000376_06 euxassay_000376_07 euxassay_000376_08 euxassay_000376_09
EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998
euxassay_000376_10 euxassay_000376_11 euxassay_000376_12 euxassay_000376_13 euxassay_000376_14
EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998
euxassay_000376_15 euxassay_000376_16 euxassay_000376_17 euxassay_000376_18 euxassay_000376_19
EMAGE:31998 EMAGE:31998 EMAGE:31998 EMAGE:31998
euxassay_000376_20 euxassay_000376_22 euxassay_000376_23 euxassay_000376_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall skeleton
weak weak
regionalweak expression: see section 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cranium
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
nasal capsule
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
axial skeleton
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3842
Entity Detected:Agc1, ( MGI:99602)
Sequence:sense strand is shown

>T3842
TGGCCTCGAGNCAGATTCGGACGAGGGNACTATCGAAGGGGACTTCCGCTGGTCTGACGGACACTCTCTG
CAATTTGAGAAGTGGCGTCCAAACCAGCCTGACAACTTCTTTGCCACCGGAGAGGACTGTGTGGTGATGA
TCTGGCATGAGAGAGGCGAATGGAACGACGTCCCCTGCAATTACCAGCTGCCCTTCACGTGTAAAAAGGG
CACCGTGGCCTGTGGAGACCCCCCAGTGGTGGAGCATGCTAGAACCCTCGGGCAGAAGAAAGATCGCTAC
GAGATCAGCTCCCTGGTGCGGTACCAGTGCACTGAGGGCTTTGTCCAGCGCCACGTGCCCACCATCCGGT
GCCAGCCCAGCGGGCACTGGGAAGAGCCTCGAATCACCTGCACAGACCCCAACACCTACAAGCACAGGCT
ACAGAAGCGGAGCATGAGACCCACACGGAGGAGCCGCCCCAGCATGGCCCACTGAGAGGAGCTTCCATAA
TGTGCCCAGGATGCTGAGCCCAGCGGCCAGCCAGGCTGACCGTGCATCCCACCCACATG
Notes:The probe template was PCR amplified from IMAGE:421307 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:421307 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000376 same experiment
 EMAGE:31958 same embryo
 EMAGE:29703 same embryo
 EMAGE:29780 same embryo
 EMAGE:29708 same embryo
 EMAGE:29840 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS