Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32123

Prlr prolactin receptor ( MGI:97763)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123
euxassay_007856_01 euxassay_007856_02 euxassay_007856_03 euxassay_007856_04 euxassay_007856_05
EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123
euxassay_007856_06 euxassay_007856_07 euxassay_007856_08 euxassay_007856_09 euxassay_007856_10
EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123
euxassay_007856_11 euxassay_007856_12 euxassay_007856_13 euxassay_007856_14 euxassay_007856_15
EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123 EMAGE:32123
euxassay_007856_16 euxassay_007856_17 euxassay_007856_18 euxassay_007856_19 euxassay_007856_20
EMAGE:32123 EMAGE:32123
euxassay_007856_21 euxassay_007856_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14 15
pituitary gland
moderate moderate
regionalmoderate expression: see section 09
stomach
weak weak
regionalweak expression: see section 04 05 06
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03 18 weak expression: see section 02
testis
strong strong
regionalstrong expression: see section 03 04 05 17 18 moderate expression: see section 19
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 18 moderate expression: see section 08 09 10 11 15 16 17 19
midgut
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
thyroid gland
strong strong
regionalstrong expression: see section 09 10 14
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 06 07 moderate expression: see section 08 09 10 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 13 14 15 16 17
adrenal gland
strong strong
regionalstrong expression: see section 05 06 07 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 12 13 14
upper lip
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 moderate expression: see section 08 09 10 11 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 06 07 moderate expression: see section 08 09 10 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1347
Entity Detected:Prlr, prolactin receptor ( MGI:97763)
Sequence:sense strand is shown

>T1347
TCGAGNCTGTTGGCCTACTGGAAATGGTGCATGTGCCTGAGCGGTTGTCATTTAACAAATGTCACCTGGT
GCTTTCTCTTCCAGGGAGCCTCTGATCTATTGCCTGTAGCAAGAAGAAGGGCCAGCCTGAAGCAAAACAT
GTCATCTGCACTTGCTTACATGCTGCTTGTCCTCAGCATCAGCCTCCTGAATGGACAGTCACCACCTGGA
AAACCTGAAATCCACAAATGTCGTTCCCCTGACAAGGAAACATTCACCTGCTGGTGGAATCCTGGGTCAG
ATGGAGGACTCCCCACCAATTATTCATTGACATACAGCAAAGAAGGAGAGAAAAACACCTATGAATGTCC
AGACTACAAAACCAGTGGCCCCAATTCCTGTTTCTTTAGCAAGCAGTACACTTCCATATGGAAAATATAC
ATCATCACAGTAAATGCCACGAACGAAATGGGAAGCAGTACCTCGGATCCACTTTATGTGGATGTGACTT
ACATTGTTGAACCAGAGCCTCCTCGGAACCTGACTTTAGAAGTGAAACAACTAAAAGACAAAAAAACATA
TCTGTGGGTAAAATGGTTGCCACCT
Notes:The probe template was PCR amplified from IMAGE:2300897 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2300897 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007856 same experiment
 EMAGE:29907 same embryo
 EMAGE:29880 same embryo
 EMAGE:29486 same embryo
 EMAGE:31338 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS