Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8865

Rasa4 RAS p21 protein activator 4 ( MGI:1858600)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865
"Pseudo-wholemount" of euxassay_010132. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010132_01 euxassay_010132_02 euxassay_010132_03 euxassay_010132_04
EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865
euxassay_010132_05 euxassay_010132_06 euxassay_010132_07 euxassay_010132_08 euxassay_010132_09
EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865
euxassay_010132_10 euxassay_010132_11 euxassay_010132_12 euxassay_010132_13 euxassay_010132_14
EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865
euxassay_010132_15 euxassay_010132_16 euxassay_010132_17 euxassay_010132_18 euxassay_010132_19
EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865 EMAGE:8865
euxassay_010132_20 euxassay_010132_21 euxassay_010132_22 euxassay_010132_23 euxassay_010132_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8865Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8865_wholemount_strong.wlz
8865_wholemount_moderate.wlz
8865_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8865_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
weak weak
regionalweak expression: see section 05 06 07 08 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32139
Entity Detected:Rasa4, RAS p21 protein activator 4 ( MGI:1858600)
Sequence:sense strand is shown

>T32139
CTGGACCCCAGCAAAGTGGAAGTTAAGGATGTAGGGTGCTCTGGGCTGCACCGCCCACAGACCGAAGCTG
AAGTGTTAGAGCAGAGTGCACAGACGCTGCGTGCCCACTTAGTGGCGCTGCTGAGCGCCATATGCCGCTC
GGTTCGCACGTGCCCAGCCATCATCCGCGCCACATTCCGGCAGCTGTTCAGGCGCGTGCGCGAGCGCTTC
CCGAACGCCCAGCACCAGAACGTACCATTCATCGCGGTCACCAGCTTCCTGTGCCTGCGCTTCTTCTCTC
CCGCCATCCTGTCGCCCAAGCTCTTCCACCTGCGAGAGCGGCATGCAGATGCCCGCACCAGCCGCACGCT
GCTTCTGCTGGCCAAGGCGGTCCAGAACATAGGCAATATGGACACACCGGTCTCTAGGGCCAAAGAGTCG
TGGATGGAACCACTCCAGCCTACCGTGCGCCAGGGCGTGGCGCAGCTGAAGGACTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4527934), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59426. Forward Primer - name:059426_F_IRAV95_e10_Rasa4, sequence:CTGGACCCCAGCAAAGTG; Reverse Primer - name:059426_R_SP6_IRAV95_e10_Rasa4, sequence:TGAAGTCCTTCAGCTGCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8862 same embryo
 EMAGE:8864 same embryo
 EMAGE:8861 same embryo
 EMAGE:8866 same embryo
 EMAGE:8863 same embryo
 EurExpress:euxassay_010132 same experiment
 MGI:4827621 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS