Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8866

Myl9 myosin, light polypeptide 9, regulatory ( MGI:2138915)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866
"Pseudo-wholemount" of euxassay_010121. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010121_01 euxassay_010121_02 euxassay_010121_03 euxassay_010121_04
EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866
euxassay_010121_05 euxassay_010121_06 euxassay_010121_07 euxassay_010121_08 euxassay_010121_09
EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866
euxassay_010121_10 euxassay_010121_11 euxassay_010121_12 euxassay_010121_13 euxassay_010121_14
EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866
euxassay_010121_15 euxassay_010121_16 euxassay_010121_17 euxassay_010121_18 euxassay_010121_19
EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866 EMAGE:8866
euxassay_010121_20 euxassay_010121_21 euxassay_010121_22 euxassay_010121_23 euxassay_010121_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8866Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8866_wholemount_strong.wlz
8866_wholemount_moderate.wlz
8866_wholemount_weak.wlz
8866_wholemount_possible.wlz
8866_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8866_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
nasal cavity
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 17 moderate expression: see section 06 14 15 16
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
heart atrium
strong strong
regionalstrong expression: see section 16 17 18 19 20 21 moderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15
heart ventricle
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
esophagus
strong strong
regionalstrong expression: see section 11 12
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
strong strong
regionalstrong expression: see section 10 11 12 13 14
left lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32141
Entity Detected:Myl9, myosin, light polypeptide 9, regulatory ( MGI:2138915)
Sequence:sense strand is shown

>T32141
TCTTAGCTGCCCCAGTGCCTAGACCCCATCCCAGTCACCTACCTCCCCAACACATACACTCTACCCTCCC
TGTGACGAATTAGGGTCCCAGCTCCCAGGGCCGGAACTGAACCGTAAGACCCACAGGGTGAGGCAGGTGC
TCTACAATGGGCCCAGGCACTAACTAGAAGGGATCTCTGACCCTACAAGGAGGGACCACAGTGGGGAGGT
GAGCCGAGGGTGGGGCCAGCAAGCACCAAGGTAAAGCCACTGAAGATAGCACTCAGCCATGCCCTCCCAT
TCCCGGGCTGCCTGAGGAAGGAAGCACCCGTGTTCTGGTGTCGGACACTAATTCCCAGCATCCCCACAAA
GGTACACACACCCATTCACCATGTCCCTTCAGAGGATGACAGTCTGCTCTTAGGCTTGTGGAGTTGTCTC
AGCACCCCCAGAATGCATTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:2644903), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59385. Forward Primer - name:059385_F_IRAV95_g02_Myl9, sequence:TCTTAGCTGCCCCAGTGC; Reverse Primer - name:059385_R_SP6_IRAV95_g02_Myl9, sequence:CTCAATGCATTCTGGGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8862 same embryo
 EMAGE:8864 same embryo
 EMAGE:8861 same embryo
 EMAGE:8863 same embryo
 EMAGE:8865 same embryo
 EurExpress:euxassay_010121 same experiment
 MGI:4826553 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS