Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11354

Taco1 translational activator of mitochondrially encoded cytochrome c oxidase I ( MGI:1917457)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354
"Pseudo-wholemount" of euxassay_003525. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003525_01 euxassay_003525_02 euxassay_003525_03 euxassay_003525_04
EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354
euxassay_003525_05 euxassay_003525_06 euxassay_003525_07 euxassay_003525_08 euxassay_003525_09
EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354
euxassay_003525_10 euxassay_003525_11 euxassay_003525_12 euxassay_003525_13 euxassay_003525_14
EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354
euxassay_003525_15 euxassay_003525_16 euxassay_003525_17 euxassay_003525_18 euxassay_003525_19
EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354 EMAGE:11354
euxassay_003525_20 euxassay_003525_21 euxassay_003525_22 euxassay_003525_23 euxassay_003525_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11354Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11354_wholemount_strong.wlz
11354_wholemount_moderate.wlz
11354_wholemount_weak.wlz
11354_wholemount_possible.wlz
11354_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11354_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 15
adenohypophysis
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 22 23 24
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 17
pons mantle layer
weak weak
regionalweak expression: see section 08 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 19
spinal cord lateral wall
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 16 17
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
not examined not examined
regionalnot examined expression: see section 01 02 03 04
naris
moderate moderate
regionalmoderate expression: see section 13 14 18 19
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 20 21
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19
tongue
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 09 19 20 21 weak expression: see section 08
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 09 19 20 21 weak expression: see section 08
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 19 20 21
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 21 22 23 24
not examined not examined
regionalnot examined expression: see section 08 09 10 11 12 13 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7416
Entity Detected:Taco1, translational activator of mitochondrially encoded cytochrome c oxidase I ( MGI:1917457)
Sequence:sense strand is shown

>T7416
CGTCAGGAAGAGCCGAACCTCTGAGTTTCTGGAGAGCTGTAGCAGCGGTCTGAACGTCCAGACCGGGTTG
TTCCGGGGCCGGACTAGACGGGCTGATTTTAGCTGCTCATCTTTGCACCGCGCAGCCCCTTGTCGAAGCA
GATGATGTCTTGGGCTGCCGCCAGCCTGAGAATGACCGCTGTCCCGTGCTTTCGTGTGCGATGCCTCGGG
TTCCGCGTGGGTCCTTGGGGCGCCTCCCAGCATGCAAACCCCGGCTGTGGTGCAGCGCCACACAGGACGC
TGCATGTCAGCGCGACGGCCTCGGCGGGACACAATAAGTGGTCTAAAGTCCGGCACATCAAGGGCCCCAA
GGACATGGAAAGGAGTCGAATCTTCTCTAAACTCACTCTCAGTATCCGCCTGGCGGTTAAAGAGGGAGGC
CCTAACCCTGAGAACAACAGCAGCCTGGCCAACATCTTAGAGTTGTGTCGCAGCAAGAATATGCCCAAGT
CAACCATCGAGTCAGCACTGAAGACAGAGAAAAACAAGGGCATTTATTTGCTATATGAGGGTCGTGGCCC
TGGAGGCTCTTCTCTGCTCATTGAGGCGTTATCAAACAGTGGTCCCAAGTGCCATCTGGACATTAAATAT
ATCCTGAACAAGAATGGGGGAATGATGGCTGAAGGAGCACGCCACTTTTTTGACAAAAAAGGAGTGGTTG
TTGTTGGAGTGGAGGACAGAGAGAAGAAAGCTGTGAACCTAGAGCGTGCCCTAGAACTGGCCATCGAAGC
AGGAGCCGAGGATGTGAAGGAAGCCGAAGACGAAGAAGAAAAGAACCTTTTTAAATTCATTTGTGATGCT
TCTTCACTACATCAAGTGAGGAAAAAACTGGACTCGCTGGGCCTGTGTCCTGTGTCCTGTTCAATGGAGT
TCATCCCTCACTCCAAGGTGCAGCTGGCTGAGCCGGAGCTGGAGCAGGCTGCTCACCTCATCCAGGCGCT
TAACAACTATGAGGATGTGATTCACGTTTATGACAATATTGAATAAGCGGCCTCGACTAGACTTGGCTCC
GGCTCTTTCCTAGGCCGCACAAGCTTCTGCAGCAATCTCAGAGACTGAAACAGCTGAGAGCCTATTAGAG
ACCTGCTGCAATGGCTGTCAGCCTTGGGAAAGGGGGACTCTTAGCTCTGTTGGTATCACCGGGCCATCTG
GAATGCAAGGTGAGACTGGCCAGCCGGTCTGACTCTGATCCCAGGTGACTGGCTCTTGTGAAGAGTCTTA
AGTGTCCTGTGGTACCGTAGAGTGGAAATGATCTTCAATAATAACAGTAGTGACTTTTGGATGCTTTGTT
GCTGGTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4195338 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4195338 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11351 same embryo
 EMAGE:11353 same embryo
 EMAGE:11350 same embryo
 EMAGE:11349 same embryo
 EMAGE:11352 same embryo
 EurExpress:euxassay_003525 same experiment
 MGI:4828582 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS