Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13726

Cnot6 CCR4-NOT transcription complex, subunit 6 ( MGI:2144529)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726
euxassay_019560_01 euxassay_019560_02 euxassay_019560_03 euxassay_019560_04 euxassay_019560_05
EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726
euxassay_019560_06 euxassay_019560_07 euxassay_019560_08 euxassay_019560_09 euxassay_019560_10
EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726
euxassay_019560_11 euxassay_019560_12 euxassay_019560_13 euxassay_019560_14 euxassay_019560_15
EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726
euxassay_019560_16 euxassay_019560_17 euxassay_019560_18 euxassay_019560_19 euxassay_019560_20
EMAGE:13726 EMAGE:13726 EMAGE:13726 EMAGE:13726
euxassay_019560_21 euxassay_019560_22 euxassay_019560_23 euxassay_019560_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13726Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13726_wholemount_strong.wlz
13726_wholemount_moderate.wlz
13726_wholemount_weak.wlz
13726_wholemount_possible.wlz
13726_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13726_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55023
Entity Detected:Cnot6, CCR4-NOT transcription complex, subunit 6 ( MGI:2144529)
Sequence:sense strand is shown

>T55023
GAAGGCGGCGGCCGGCGCGGCGAGGAGGGCGAGGCCGGGGTCCGAGAGGGCGGCAGAGCGTAGCGGCGGC
TCGTGGGGTCCGGGGCGGCCGAGGCGGGCGGCTGAGGAGCGGCGGCCGAGGAGGGGGAACAAAGAGCGGC
GGCGGAGGCGCTGCAGCAGCGGGCGGGACTGGTATGGTGGTTCCACAGGGCAGACCCCGCTGCACTCATC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GAAGGCGGCGGCCGGCGCGG; Reverse Primer - name:unspecified, sequence:GATGAGTGCAGCGGGGTCTG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13723 same embryo
 EMAGE:13727 same embryo
 EMAGE:13724 same embryo
 EMAGE:13725 same embryo
 EurExpress:euxassay_019560 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS