Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18798

Zfp703 zinc finger protein 703 ( MGI:2662729)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798
"Pseudo-wholemount" of euxassay_014263. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014263_01 euxassay_014263_02 euxassay_014263_03 euxassay_014263_04
EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798
euxassay_014263_05 euxassay_014263_06 euxassay_014263_07 euxassay_014263_08 euxassay_014263_09
EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798
euxassay_014263_10 euxassay_014263_11 euxassay_014263_12 euxassay_014263_13 euxassay_014263_14
EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798 EMAGE:18798
euxassay_014263_15 euxassay_014263_16 euxassay_014263_17 euxassay_014263_18 euxassay_014263_19
EMAGE:18798 EMAGE:18798 EMAGE:18798
euxassay_014263_20 euxassay_014263_21 euxassay_014263_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18798Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18798_wholemount_strong.wlz
18798_wholemount_moderate.wlz
18798_wholemount_weak.wlz
18798_wholemount_possible.wlz
18798_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18798_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 04 05 06 20
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 08 09 10 11 14 15 16 17 18
pons marginal layer
weak weak
regionalweak expression: see section 09 10 14 15
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 11 13 16 17 18
ventral grey horn
weak weak
regionalweak expression: see section 09 11 12
eye
weak weak
regionalweak expression: see section 20
extrinsic ocular muscle
weak weak
regionalweak expression: see section 05 19 20
esophagus
weak weak
regionalweak expression: see section 11 12
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 18
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40140
Entity Detected:Zfp703, zinc finger protein 703 ( MGI:2662729)
Sequence:sense strand is shown

>T40140
GGCCATCCTCTCTACACCTATGGCTTCATGCTGCAGAACGAACCGCTGCCACACAGCTGCAATTGGGTGG
CGGCCAGCGGGCCCTGCGACAAGCGCTTTGCCACCTCTGAGGAGCTGCTCAGCCATCTACGGACTCACAC
AGCCCTGCCGGGCGCAGAGAAACTTCTGGCCGCCTACCCCGGGGCGTCGAGCTTGGGCAGTGCCGCTGCA
GCCGCTGCAGCCGCAGCCTCTTGTCACCTGCATCTCCCCCCGCCCGCTGCCCCAGGCAGCCCCGGGTCGC
TGTCCTTGCGGAGTCCACACACTTTGGGGCTAAGCCGATACCACCCCTATGGCAAGAGCCACTTATCTAC
AGCTGGGGGCCTGGCAGTGCCGTCCCTTCCCACAGCCGGACCCTACTACTCGCCATACGCACTGTATGGA
CAGAGACTAGCCTCCGCCTCTGCGCTTGGATACCAGTAACCACAGCTCTGGCCCCTCCCAGCCCTTCCCC
ACCCACCCCTTCCTCTCACGTCCCACTGCCTTCGACGCTGCAAGCTCCACTACCGCTTACCCCTACCAGG
ATCCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 164007. Forward Primer - name:164007_F_cDNA_mCG2244.2, sequence:GGCCATCCTCTCTACACCTATG; Reverse Primer - name:164007_N_SP6_cDNA_mCG2244.2, sequence:GCTGGATCCTGGTAGGGGTAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18799 same embryo
 EMAGE:18801 same embryo
 EMAGE:18802 same embryo
 EMAGE:18800 same embryo
 EMAGE:18803 same embryo
 EurExpress:euxassay_014263 same experiment
 MGI:4829334 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS