EMAGE mouse gene expression spatial database

EMAGE:18800

LOC676300 (LOC676300)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_014256. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_014256_01	euxassay_014256_02	euxassay_014256_03	euxassay_014256_04

euxassay_014256_05	euxassay_014256_06	euxassay_014256_07	euxassay_014256_08	euxassay_014256_09

euxassay_014256_10	euxassay_014256_11	euxassay_014256_12	euxassay_014256_13	euxassay_014256_14

euxassay_014256_15	euxassay_014256_16	euxassay_014256_17	euxassay_014256_18	euxassay_014256_19

euxassay_014256_20	euxassay_014256_21	euxassay_014256_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T39757
Entity Detected:	LOC676300, (LOC676300)
Sequence:	sense strand is shown >T39757 TTTGATTCTTCTGCCTCTCTCCTCTTGATCTTTCTTACCCTCTGCTTCCCCAAGTGCAGTTGAGGTACTA TGCAGTGCCTCCGCCTCACTCCAAACATGGGAATTCAATCTCAGAGGAGGTAAGAAGTGGGGAGAAGCCA AGACTCAGCAATAGACGATAATTGCTCCTGGGATTGCCCCTAACACCATTTACCTAGAAAGGACCAAGTT TGGATCCTGAAGCCCAGTGGAGCACCATTCTCTGCCTGAATCCTGTTGTGATCCCTAGCCAAGTCCTCTT TCCAAAAACTCCACCTTTAAAACAAGCTGAGAAGGCCCTTCTCTAAGTTTAATAGTTAACTTTCCATAGC TTAGCTTCTCTGCGGTCTCCTGAGTGCCCAGTGAAAATTCTGCCATAGGTC
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 162277. Forward Primer - name:162277_F_cDNA_mCG5349.2, sequence:TTTGATTCTTCTGCCTCTCTCC; Reverse Primer - name:162277_N_SP6_cDNA_mCG5349.2, sequence:GACCTATGGCAGAATTTTCACTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:18799 same embryo
	EMAGE:18801 same embryo
	EMAGE:18802 same embryo
	EMAGE:18803 same embryo
	EMAGE:18798 same embryo
	EurExpress:euxassay_014256 same experiment
	Allen Brain Atlas same gene
	BioGPS same gene
	BrainStars same gene
	ViBrism same gene
Data Source