Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18802

9330169B04Rik RIKEN cDNA 9330169B04 gene ( MGI:2443134)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802
"Pseudo-wholemount" of euxassay_014245. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014245_01 euxassay_014245_02 euxassay_014245_03 euxassay_014245_04
EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802
euxassay_014245_05 euxassay_014245_06 euxassay_014245_07 euxassay_014245_08 euxassay_014245_09
EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802
euxassay_014245_10 euxassay_014245_11 euxassay_014245_12 euxassay_014245_13 euxassay_014245_14
EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802 EMAGE:18802
euxassay_014245_15 euxassay_014245_16 euxassay_014245_17 euxassay_014245_18 euxassay_014245_19
EMAGE:18802
euxassay_014245_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18802Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18802_wholemount_strong.wlz
18802_wholemount_moderate.wlz
18802_wholemount_weak.wlz
18802_wholemount_possible.wlz
18802_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18802_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 14 15
diencephalon
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
vibrissa
weak weak
regionalweak expression: see section 05 06 07 17 18
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
hindbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18
midbrain
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
strong strong
single cellstrong expression: see section 04 05 17
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 06 15
trigeminal v ganglion
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 14 15 16 17 18 19
vagus x ganglion
strong strong
single cellstrong expression: see section 07
vestibulocochlear viii ganglion
strong strong
single cellstrong expression: see section 06 07 15 16
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 11 12 13 14
neural retina
weak weak
regionalweak expression: see section 01 02 03 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40447
Entity Detected:9330169B04Rik, RIKEN cDNA 9330169B04 gene ( MGI:2443134)
Sequence:sense strand is shown

>T40447
ACTCCCACCAAACCATATCATCAGGTTCTTGGATGTGTGTGTCCCTATGCCATGGTGTGCCTGTGTGGGT
CAGAGGACAGTTTGCAGGAGTTGGTTCCCTCCTTCCACCTGGTTACCAAGGATCAAACTCAAACGATCAG
GGTTGATTGCAAGTGCCTTGACGTGCTGAGACATCATCTCGCCAGATCCCTGTCTGTGTTGTTTTGTTTG
GTTTTGTTTGGTTTGGTTTGGTTTGGTTTGGTATTGTTGTTTTTTGGAGATAGGGTTTCTATGTAGCCCT
GGTTGTAGCCCTGGCTATCCTGGAACTCACTTTAGACCAGGCTGACCTCCAACTCTGCTTCCCAGAGTGC
TGGGATCAAAGGTATGCGCCATCACTGCCTGGCATATTTCTGTGACATACATGTGCTTGCACAATCACAC
ACACAATAAATATTTAACATGGGGCTGGAGAGATGTCTCAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 158907. Forward Primer - name:158907_F_cDNA_Mm.118131, sequence:ACTCCCACCAAACCATATCATC; Reverse Primer - name:158907_N_SP6_cDNA_Mm.118131, sequence:ACTGAGACATCTCTCcagccc. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18799 same embryo
 EMAGE:18801 same embryo
 EMAGE:18800 same embryo
 EMAGE:18803 same embryo
 EMAGE:18798 same embryo
 EurExpress:euxassay_014245 same experiment
 MGI:4822801 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS