Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18801

LOC673219 (LOC673219)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801
"Pseudo-wholemount" of euxassay_014182. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014182_01 euxassay_014182_02 euxassay_014182_03 euxassay_014182_04
EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801
euxassay_014182_05 euxassay_014182_06 euxassay_014182_07 euxassay_014182_08 euxassay_014182_09
EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801
euxassay_014182_10 euxassay_014182_11 euxassay_014182_12 euxassay_014182_13 euxassay_014182_14
EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801 EMAGE:18801
euxassay_014182_15 euxassay_014182_16 euxassay_014182_17 euxassay_014182_18 euxassay_014182_19
EMAGE:18801 EMAGE:18801
euxassay_014182_20 euxassay_014182_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18801Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18801_wholemount_strong.wlz
18801_wholemount_moderate.wlz
18801_wholemount_weak.wlz
18801_wholemount_possible.wlz
18801_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18801_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
regionalstrong expression: see section 11 moderate expression: see section 07 08 09 10 12 13 14 15 16 17 18 19
pleura
strong strong
regionalstrong expression: see section 11 moderate expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20
adrenal medulla
moderate moderate
regionalmoderate expression: see section 04 05 06 13 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 10 14 moderate expression: see section 09 11 15
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 07 08 16 17
heart
strong strong
regionalstrong expression: see section 13
heart atrium
strong strong
regionalstrong expression: see section 10 11 13 14
vena cava
strong strong
regionalstrong expression: see section 08 09 10
urogenital mesentery
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 15 16 17 18
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 12 13
testis
moderate moderate
regionalmoderate expression: see section 03 04 05 15 16 17
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09
right lung
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40439
Entity Detected:LOC673219, (LOC673219)
Sequence:sense strand is shown

>T40439
ATGCTGGCTGTGTTAACCCTATTTCTCCTGGTTTGATCCTGCACTCACCAGAAGTGGCGCTGAAAGAAAA
AGTTTTGAATGCTGTGAAGCACAGTCAGACGGACGTATATAAGCTGCAGTGCTTGTCTCATATTTAAGCC
TCTCGTAGATAAGGGAGCAGTATGGGAAATTCACATTCTTTAACTACAGCTCTACACTCTGTTTTAAAAC
AGCGAGAGATAAAAGTTTCTACAAGAACCTTAGAAACGTTCATTAGGGAAATAGAACGTATATCACCTTG
GTACGCGTGTTCAGGGTCGTTAACTCTTTCCTCTTGGGAGAAATTAAGGGAAGACTTAGCTAAGGAACAA
CAGAATGGGAAATTAAAGGCAGGGACCATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 161157. Forward Primer - name:161157_F_cDNA_mCG115405, sequence:ATGCTGGCTGTGTTAACCCTAT; Reverse Primer - name:161157_N_SP6_cDNA_mCG115405, sequence:CATGGTCCCTGCCTTTAATTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18799 same embryo
 EMAGE:18802 same embryo
 EMAGE:18800 same embryo
 EMAGE:18803 same embryo
 EMAGE:18798 same embryo
 EurExpress:euxassay_014182 same experiment
 MGI:4822791 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS