Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30927

Elovl2 ( MGI:1858960)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927
euxassay_006217_01 euxassay_006217_02 euxassay_006217_03 euxassay_006217_04 euxassay_006217_05
EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927
euxassay_006217_06 euxassay_006217_07 euxassay_006217_08 euxassay_006217_09 euxassay_006217_10
EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927
euxassay_006217_11 euxassay_006217_12 euxassay_006217_13 euxassay_006217_14 euxassay_006217_15
EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927 EMAGE:30927
euxassay_006217_16 euxassay_006217_17 euxassay_006217_18 euxassay_006217_19 euxassay_006217_20
EMAGE:30927 EMAGE:30927 EMAGE:30927
euxassay_006217_21 euxassay_006217_22 euxassay_006217_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
adenohypophysis
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 weak expression: see section 08 09 10 11 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 07
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13
liver right lobe
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23
kidney calyx
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 08 09
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13
brain
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 08 09 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T682
Entity Detected:Elovl2, ( MGI:1858960)
Sequence:sense strand is shown

>T682
TCCTCGAGNCTGTTGGCCTACTGGATGTTTTAAACTCGTAACTATACCACCCTTCTCACTGGTGTATTTT
GAAAACCACCACAGTCCGATGTCCTGTGCCATGTCTGTCATTCCTGTTGAACAGACTCTTCCTGTCTGGT
GACCACCTATGCTTCAGTGCATTTTCTAAACAATTTCTCAAACTGATCTGCTCCCGGGTGCTTTCTTACC
ACCATCTCTGGTGACTTAGCCTCAAATTGGTGTTTTTCTTTCCCAAGAATTCATCTTAAGGGTTAGCTTT
GAGTATGTTACTGTCCTTCTATGACAAGACCAAAGGAACAAACTCCTTGGTGAATCTGGAGTTCAGCTTT
AGTTTTCAAACACAATCTGAAATCTGTTAGTAAAATGAATTCTGGGTAAAAATGAGACTCAAGAGGCATC
ACTGGCCATTGTACCAGATTATTCCTGCTCGCCAGTGAGAGGCGTTTAAGTCGCGCTGTGCATCGTACCT
TCAGTTTAGGCTGTTTTCATGACCTCACATCTGTGTAGCACAAAGGGTGTTATCTTCC
Notes:The probe template was PCR amplified from IMAGE:1888722 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888722 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006217 same experiment
 EMAGE:31817 same embryo
 EMAGE:31784 same embryo
 EMAGE:30870 same embryo
 EMAGE:30011 same embryo
 EMAGE:30843 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS