Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30960

Slc1a3 ( MGI:99917)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960
euxassay_001899_01 euxassay_001899_02 euxassay_001899_03 euxassay_001899_04 euxassay_001899_05
EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960
euxassay_001899_06 euxassay_001899_07 euxassay_001899_08 euxassay_001899_09 euxassay_001899_10
EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960
euxassay_001899_11 euxassay_001899_12 euxassay_001899_13 euxassay_001899_14 euxassay_001899_15
EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960 EMAGE:30960
euxassay_001899_16 euxassay_001899_17 euxassay_001899_18 euxassay_001899_19 euxassay_001899_20
EMAGE:30960 EMAGE:30960
euxassay_001899_21 euxassay_001899_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 15 16 17 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 11
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12
tongue
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 14
pons ventricular layer
strong strong
homogeneousstrong expression: see section 04 05 06 08 09 10 11 12 13 14 15 16 17
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 13 14
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 15 16 17 18 19 weak expression: see section 20
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 08 13 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 08 09 10 11 12 13 14 15
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 12 13
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 17 moderate expression: see section 16 weak expression: see section 08
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2570
Entity Detected:Slc1a3, ( MGI:99917)
Sequence:sense strand is shown

>T2570
TGGCCTCGAGCCAGATTCGGACGAGGTTCAGAATGCAACTGAGTTTTAATCTTAAAACATTACAACTTGA
TGAGCAATTATCAGTTACCCATTGAGTAGCTGAGAGGTTCCCATTTCTTCTGACTCCTGCCCTGACTTTG
TCAGCATCAGGGCAATCCCCACATGCACACAGCACAGCTGTGAGGAGGAGCGGAGAGTGAGGCTCCCAAA
TGGTCTAGAGTGAGCCTTGTCTCATCCATTGGCCTCAGTGTTCTCATCCGGAAAATGAGTGACTCCTAGA
CAGGCCTCTCTAGCCCAAACTTCTGGAACATCAGGAAGGACCCTGCCCCTGTACACCATGAGGATCTCAG
ACAGGACACTTATTGGGAATGGACATTTCTCTCTAGGGGCAGGCTGTGTGTGGCTCACTAGATCCTGGGT
TCAAAATGTTCGTTCTATCAGTAGACAGGTGGAAGGCCATCCTAGAAGGCCTATTGTCCTGTTTTGTTTT
CCAATACTAGAGGCCCTCCCTTCTGGGGTACACTTCCCAAATCCAAGGGAAGACA
Notes:The probe template was PCR amplified from IMAGE:1382962 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382962 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001899 same experiment
 EMAGE:29739 same embryo
 EMAGE:31729 same embryo
 EMAGE:30963 same embryo
 EMAGE:31446 same embryo
 EMAGE:31731 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS