Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30963

Rod1 ( MGI:1923334)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963
euxassay_001898_01 euxassay_001898_02 euxassay_001898_03 euxassay_001898_04 euxassay_001898_05
EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963
euxassay_001898_06 euxassay_001898_07 euxassay_001898_08 euxassay_001898_09 euxassay_001898_10
EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963
euxassay_001898_11 euxassay_001898_12 euxassay_001898_13 euxassay_001898_14 euxassay_001898_15
EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963 EMAGE:30963
euxassay_001898_16 euxassay_001898_17 euxassay_001898_18 euxassay_001898_19 euxassay_001898_20
EMAGE:30963 EMAGE:30963
euxassay_001898_21 euxassay_001898_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 weak expression: see section 11 12 13
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 17 18 19 20 weak expression: see section 06 07 16
renal cortex
moderate moderate
regionalmoderate expression: see section 04 05 06 07 14 15 16 17
kidney pelvis
moderate moderate
regionalmoderate expression: see section 06
vibrissa
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17
liver
moderate moderate
regionalmoderate expression: see section 01 02
liver lobe
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2571
Entity Detected:Rod1, ( MGI:1923334)
Sequence:sense strand is shown

>T2571
TGGCCTCGAGGCCAGATTCGGCACGAGGTAAATTTCAAAATGACACTGTCTAGTAATGTAATGTGATCTT
GGAAAATTTTAAAAGAAAAATAATCCTACTTTTTTATAATTGTTTTCAGAAAAAAAGTTTACAGTCTTAA
GGAAAAATATTCAGGTCTATCATATGGTTTGACAGATTTTTTAAAAGTTATTTTTGGTAAGGTCTTCTTT
TAGAAAAAAAAATCTCAAGGGTTTTTTGTACCACTATAATCTCTAATACTCAGAATTACTGTGTATTTAC
TTAATTTCTTATTATGTGCCTTATTATGTGCTTAAGATACAATAGATTAGAATTTTATCTAAATATCTAG
AAAGATAAATTGTGGGCTTGGTGAGCATTCTGTTATTTTTTCCTGTCTTGGATTTTAAGGGTTTTGGTTG
TTTTTGTTTTGTTTTTTTCTTTTTTTCTCGTTGCAATTTTAAGTGGTTTTCAATAAGTAATAGTTTCTAC
TCAGATTTTTGGTGCTTTGGGATAGTGGTGGGATAGAGAAGGGTGAGTGGATTGGGAATAAATAACTCAG
TGTGCACCTG
Notes:The probe template was PCR amplified from IMAGE:1383010 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383010 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001898 same experiment
 EMAGE:29739 same embryo
 EMAGE:31729 same embryo
 EMAGE:30960 same embryo
 EMAGE:31446 same embryo
 EMAGE:31731 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS