Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31446

Nexn ( MGI:1916060)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446
euxassay_002009_01 euxassay_002009_02 euxassay_002009_03 euxassay_002009_04 euxassay_002009_05
EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446
euxassay_002009_06 euxassay_002009_07 euxassay_002009_08 euxassay_002009_09 euxassay_002009_10
EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446
euxassay_002009_11 euxassay_002009_12 euxassay_002009_13 euxassay_002009_14 euxassay_002009_15
EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446 EMAGE:31446
euxassay_002009_16 euxassay_002009_17 euxassay_002009_18 euxassay_002009_19 euxassay_002009_20
EMAGE:31446 EMAGE:31446
euxassay_002009_21 euxassay_002009_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 08 09 15 16 17 18 19 20 21 22
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
heart ventricle
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 13 14 15 16 17 19 20 21 22
tongue
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2569
Entity Detected:Nexn, ( MGI:1916060)
Sequence:sense strand is shown

>T2569
TGGCCTCGAGGCCAGATTCGGCACGAGGCTANAAGAATTGAAGAACAAAAGTTACTACGAATGCAGTTTG
AACAGAAAGAAATCGATGCGGCATTACAGAAGAAAAGAGAAGATGAGGAGGAAGAAGAAGGTAGCATTGT
TAATGGCTCCACTACTGAAGATGAAGAGCAAACCAGATCAGGAGCTCCATGGTTCAAAAAGCCTTTAAGA
AATACCTCAGTTGTAGACAGTGAGCCAGTCAGATTTACTGTTAAAGTAACAGGAGAACCCAAGCCGGAAA
TTACATGGTGGTTTGAAGGAGAAATACTGCAGGATGGAGAAGACTATCAGTACATCGAAAGAGGTGAAAC
TTACTGCCTGTATTTACCGGAAACCTTCCCAGAAGATGGAGGAGAGTACATGTGTAAGGCAGTCAACAAT
AAAGGCTCAGCAGCGAGCACCTGCATTCTTACCATTGAAATGGATGACTACTAGGCTTCCCTCTGTCCTT
GGGACTCTCTCTCTCGCTGCATCTCTGTGGAGGGGCCAAAAAGGAGACCAGA
Notes:The probe template was PCR amplified from IMAGE:1382937 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382937 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002009 same experiment
 EMAGE:29739 same embryo
 EMAGE:31729 same embryo
 EMAGE:30960 same embryo
 EMAGE:30963 same embryo
 EMAGE:31731 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS