Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31986

Stard3nl ( MGI:1923455)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986
euxassay_012114_01 euxassay_012114_02 euxassay_012114_03 euxassay_012114_04 euxassay_012114_05
EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986
euxassay_012114_06 euxassay_012114_07 euxassay_012114_08 euxassay_012114_09 euxassay_012114_10
EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986
euxassay_012114_11 euxassay_012114_12 euxassay_012114_13 euxassay_012114_14 euxassay_012114_15
EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986
euxassay_012114_16 euxassay_012114_17 euxassay_012114_18 euxassay_012114_19 euxassay_012114_20
EMAGE:31986 EMAGE:31986 EMAGE:31986 EMAGE:31986
euxassay_012114_21 euxassay_012114_22 euxassay_012114_23 euxassay_012114_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 03 04
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 09 10 21 22
sternum
strong strong
regionalstrong expression: see section 16 17
radius
strong strong
regionalstrong expression: see section 01 02
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05 24
ulna
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 24
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 21 22 23 24
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 20 21 moderate expression: see section 11 12
axial skeleton
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 11 12
tarsus
strong strong
regionalstrong expression: see section 07
nose
strong strong
regionalstrong expression: see section 09 10 11 12 19 20 21 22 23
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 24
otic capsule
strong strong
regionalstrong expression: see section 10 11 12 19 20 21
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 21 22 23 24
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 21 22 23
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 16
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 21 22 23 24
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 16 17
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 23 24
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 10 21 22
thyroid cartilage
strong strong
regionalstrong expression: see section 19 moderate expression: see section 14 15 16 17 18
vault of skull
strong strong
regionalstrong expression: see section 01 02 03
fibula
strong strong
regionalstrong expression: see section 01 02 03 04 05
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 13 14 15 18 19 20 21 22 23 24 moderate expression: see section 08 09 10 11 12
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 21 22 23
hyoid
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20
arytenoid cartilage
moderate moderate
regionalmoderate expression: see section 15 17
meckel's cartilage
strong strong
regionalstrong expression: see section 04 05 06 07 08 21 22 23 24 moderate expression: see section 09 10 11 12 13 14 15 16 17 18 20
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21 22
scapula
strong strong
regionalstrong expression: see section 05 06 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30741
Entity Detected:Stard3nl, ( MGI:1923455)
Sequence:sense strand is shown

>T30741
AGCCAGAGCTCACACGCTTCTCTGCGAGACATCCATTCCATCAACCCTGCGCAGCTCATGGCCAGGATTG
AGTCCTATGAAGGAAGGGAAAAGAAAGGCATTTCTGATGTCGGGAGGACTTTTTGTCTCTTTGTCACCTT
TGACCTCTTATTTGTAACGTTACTGTGGATAATAGAGTTAAATGTGAACGGAGGCATCGAGAACACCCTG
AAGAAGGAAGTGATTCACTATGACTACTACTCCTCTTACTTTGATATATTTCTTTTGGCAGTTTTTCGAT
TCAAAGTGCTGATACTTGGGTATGCTGTATGCAGATTGCGCCATTGGTGGGCAATAGCGTTAACAACAGC
AGTGACCAGTGCCTTTCTATTAGCAAAAGTGATCCTCTCAAAGCTTTTCTCTCAAGGGGCATTTGGCTAT
GTGTTGCCCATCATTTCATTCATCCTTGCCTGGATTGAGACGTGGTTCCTGGATTTCAAAGTGTTACCTC
AAGAGGCAGAAGAAGAAAACAGACTCCTGCTCGTTCAGGATGCGTCCGAGAGGGCAGCTCTCATCCCCGC
AGGGCTCTCTGATGGTCAGTTTTACTCCCCTCCTGAGTCTGAAGCAGGATCTGAAGAAGAAGCTGAGGAA
AAACAGGAGAGTGAGAAACCGCTTTTGGAACTATGAGTTCTGCTCTGTGAATGTGAAGAACCTCACTGCG
AGTCATCCAAGGAAGACAGCTGAAGTGGTGGCTCTGCTTGCTGCTGGATGCTGAGGAGCTAGTGAGTTTA
TTTATGGTGATACCTCATGGACATCGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3256725), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11764. Forward Primer - name:011764_F_IRAV01-03_G04_Stard3nl, sequence:AGCCAGAGCTCACACGCT; Reverse Primer - name:011764_R_SP6_IRAV01-03_G04_Stard3nl, sequence:GGAGCGATGTCCATGAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012114 same experiment
 EMAGE:31990 same embryo
 EMAGE:30652 same embryo
 EMAGE:30651 same embryo
 EMAGE:32008 same embryo
 EMAGE:30650 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS