Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31990

Tmem50b transmembrane protein 50B ( MGI:1925225)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990
euxassay_012115_01 euxassay_012115_02 euxassay_012115_03 euxassay_012115_04 euxassay_012115_05
EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990
euxassay_012115_06 euxassay_012115_07 euxassay_012115_08 euxassay_012115_09 euxassay_012115_10
EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990
euxassay_012115_11 euxassay_012115_12 euxassay_012115_13 euxassay_012115_14 euxassay_012115_15
EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990
euxassay_012115_16 euxassay_012115_17 euxassay_012115_18 euxassay_012115_19 euxassay_012115_20
EMAGE:31990 EMAGE:31990 EMAGE:31990 EMAGE:31990
euxassay_012115_21 euxassay_012115_22 euxassay_012115_23 euxassay_012115_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 09
sternum
moderate moderate
regionalmoderate expression: see section 16
radius
strong strong
regionalstrong expression: see section 01 02
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05
ulna
strong strong
regionalstrong expression: see section 02
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 01
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 22
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 07 08 09
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 12
axial skeleton
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 12 13 14 15 16
nose
strong strong
regionalstrong expression: see section 09 10 11 12
otic capsule
strong strong
regionalstrong expression: see section 11 12
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 22 23 24 weak expression: see section 07
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 10
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 07 08 09
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 04 05 06 07 08 09 10
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 20 21 22 23 24 weak expression: see section 06 07 08 09 10 11
tibia
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 moderate expression: see section 01 02 03 04
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 15 16
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09
upper arm rest of mesenchyme
strong strong
regionalstrong expression: see section 07
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 18 19 20
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
vault of skull
strong strong
regionalstrong expression: see section 01
fibula
strong strong
regionalstrong expression: see section 05 moderate expression: see section 02 03 04
rib
strong strong
regionalstrong expression: see section 01 02 05 06 09 10 moderate expression: see section 03 04 07 08 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 08 09
hyoid
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
arytenoid cartilage
moderate moderate
regionalmoderate expression: see section 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 13 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 19 20
meckel's cartilage
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 moderate expression: see section 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
hand mesenchyme
strong strong
regionalstrong expression: see section 02 03
scapula
strong strong
regionalstrong expression: see section 04 05 06 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30743
Entity Detected:Tmem50b, transmembrane protein 50B ( MGI:1925225)
Sequence:sense strand is shown

>T30743
CTCCCGAGCCAGGGTTATGCTGTCTTGGTGTTTAGAGGTAAATACTTTGTCTTGGTATCTCTGATGTTTG
AAAATGTGCAAAATACACAGCTCCGTGTCCCTAGAGGCCCTGAGCCATTAACGAAGGCATTTCTGCCAGG
TGTAATTTATTCTGACTTAGCAATGAGATTTTTTTTTCAAGGAAAAAAAAGTTTGTGCATATGTATTAAA
GAGCTGGACTTTTTATATGAAGATTTTTTTAAATGCCCAAAGGACTAGTTTGAAAGCCCTCTTTGCAAAG
AATTCCTCTAACTTGACTTTTGTTTGAGAAGGGATAACACAGAGATAACACTCCATTTTGTAAATCAGAC
GGCAGGCAGCTGAGCTCTGTGCTTCCCGTCTCACCGAGCAGCTTGGATGCCCAGGTTGTTGTTGTGGATG
GCCTGCCTCCGTCCGGCATTAACACACAGCAAGGGACCCTGCAGCAGCCGCAGTTTAGATGCATGGCCAA
GTGGAATAACTAGCTAACGACCTCTTCCCGAAGGGCGCTGTGACCTACAAAAGGCCAGCTGCTTCACTCA
GTTTGTTCTGACTCCTTCTGTGTAGCTCTCAGGCTCTGGGCGCCCAGCTGCTGCAGAGTACAGGTATCCT
GTACTGAAAGTTCGCACTCCACACCAGACCCTCCTTCCCATGTTTGAGCGCTGCGCTTGCCCCAAGTATA
TTTCTGTGGGCCTTTCCCTTGAGTCAAGATTTTGTGTTGCACTTTCAACCCGAGAGGATTTTTATAAGAC
AATTTGCTGTAAACCAGTAGTAAGGATGGAAGCAGTGCACCTCCCATGCAGGCCTCACTTTACTTAGCGG
CCTCTCTGAGAGGCCCCTCCAAGCACAGCGCGTGAAGCGTCTGCTGATCGCTGCGCTTCATCCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:2649264), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11654. Forward Primer - name:011654_F_IRAV01-03_G09_B230114J08Rik, sequence:CTCCCGAGCCAGGGTTAT; Reverse Primer - name:011654_R_SP6_IRAV01-03_G09_B230114J08Rik, sequence:ATCAGGATGAAGCGCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012115 same experiment
 EMAGE:30652 same embryo
 EMAGE:30651 same embryo
 EMAGE:32008 same embryo
 EMAGE:30650 same embryo
 EMAGE:31986 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS