Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13629

Pgpep1 pyroglutamyl-peptidase I ( MGI:1913772)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629
"Pseudo-wholemount" of euxassay_019252. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019252_01 euxassay_019252_02 euxassay_019252_03 euxassay_019252_04
EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629
euxassay_019252_05 euxassay_019252_06 euxassay_019252_07 euxassay_019252_08 euxassay_019252_09
EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629
euxassay_019252_10 euxassay_019252_11 euxassay_019252_12 euxassay_019252_13 euxassay_019252_14
EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629
euxassay_019252_15 euxassay_019252_16 euxassay_019252_17 euxassay_019252_18 euxassay_019252_19
EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629 EMAGE:13629
euxassay_019252_20 euxassay_019252_21 euxassay_019252_22 euxassay_019252_23 euxassay_019252_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13629Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13629_wholemount_strong.wlz
13629_wholemount_moderate.wlz
13629_wholemount_weak.wlz
13629_wholemount_possible.wlz
13629_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13629_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 18 19 20 21
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 13 14 18 19 weak expression: see section 12
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 14 15 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 17 18 weak expression: see section 10
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 18 19 20 21 22 23 moderate expression: see section 13 14 15 16 17 24
pons mantle layer
weak weak
regionalweak expression: see section 08 19
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 17 18 weak expression: see section 12 15
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 14
metanephros
moderate moderate
regionalmoderate expression: see section 08 09 10 21 22 weak expression: see section 18 19 20
testis
strong strong
regionalstrong expression: see section 06 07 21 22 moderate expression: see section 08 09 18 19 20
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T799
Entity Detected:Pgpep1, pyroglutamyl-peptidase I ( MGI:1913772)
Sequence:sense strand is shown

>T799
TCCTCGAGNCTGTTGGCCTACTGGAGAGAGTGCATTCCACCATGGAGCAGCCGCGGAAGGCGGTAGTGGT
AACCGGATTCGGCCCTTTTGGGGAGCATACTGTGAATGCCAGCTGGATCGCTGTCCAGGAGCTGGAGAAG
CTGGGCCTCGGGGACAGCGTGGACCTGCATGTGTACGAGATCCCCGTGGAATACCAGACGGTGCAGAGGC
TCATCCCAGCACTGTGGGAGAAGCACAGCCCCCAGCTCGTAGTGCATGTTGGGGTGTCGGGCATGGCCAC
CACAGTGACGCTGGAAAAATGTGGGCACAACAAGGGTTACAAAGGACTGGATAATTGCCGGTTCTGCCCC
GGCTCTCAGTGCTGCGTGGAGGATGGTCCCGAGAGCATCGACTCCATCATCGACATGGACGCCGTGTGCA
AAAGGGTGACCACACTGGGACTGGACGTGTCTGTTACCATCTCCCAGGATGCTGGCAGGTATCTGTGTGA
CTTCACGTATTATACATCGCTCTACCAGGGCCGCGGCCGCTCCGCTTTTGTCCACGTGCCC
Notes:The probe template was PCR amplified from IMAGE:1921042 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1921042 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13634 same embryo
 EMAGE:13633 same embryo
 EMAGE:13632 same embryo
 EMAGE:13630 same embryo
 EMAGE:13631 same embryo
 EurExpress:euxassay_019252 same experiment
 MGI:4827177 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS