Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30843

F13b ( MGI:88379)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843
euxassay_006248_01 euxassay_006248_02 euxassay_006248_03 euxassay_006248_04 euxassay_006248_05
EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843
euxassay_006248_06 euxassay_006248_07 euxassay_006248_08 euxassay_006248_09 euxassay_006248_10
EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843
euxassay_006248_11 euxassay_006248_12 euxassay_006248_13 euxassay_006248_14 euxassay_006248_15
EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843 EMAGE:30843
euxassay_006248_16 euxassay_006248_17 euxassay_006248_18 euxassay_006248_19 euxassay_006248_20
EMAGE:30843 EMAGE:30843 EMAGE:30843
euxassay_006248_21 euxassay_006248_22 euxassay_006248_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 weak expression: see section 10 11 12
liver right lobe
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T572
Entity Detected:F13b, ( MGI:88379)
Sequence:sense strand is shown

>T572
GTTGGCCTACTGGAGAGCTGTGAAAATCTTCATGAGACACACTGATGATGACGCTGAGACACTTGCCATT
TATTCTTTTATTAATCCTCTCAGGAGAACTCTATGCAGAAGAGAAACAGTGTGATTTTCCTACCGTGGAA
AATGGAAGGATTGCCCAATATTATTATACGTTTAAAAGCTTTTACTTCCCCATGAGCGTAGACAAAAAAC
TATCATTCTTCTGTTTGGCTGGCTATGCAACCGAAAGTGGGAAGCAAGAAGAGCAAATCAGGTGCACAGC
AGAAGGCTGGTCTCCAAACCCAAGGTGCTACAAGAAATGTCTGAAGCCTGACCTAAGGAATGGCTACGTC
TCCAATGACAAAGTACTGTACAAACTTCAAGAGAGGATGAGCTACGGTTGCTCTTCAGGATACAAAACCA
CTGGGGGAAAGGACGAGGAGGTGGTCCACTGTCTTTCTGCAGGGTGGTCTTCTCAACCGTCCTGCAGGAA
AGAACAAGAGACATGTTTGGCCCCTGAGTTGGAACATGGAAATTAC
Notes:The probe template was PCR amplified from IMAGE:1885012 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885012 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006248 same experiment
 EMAGE:30927 same embryo
 EMAGE:31817 same embryo
 EMAGE:31784 same embryo
 EMAGE:30870 same embryo
 EMAGE:30011 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS