Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31531

Npm1 nucleophosmin 1 ( MGI:106184)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531
euxassay_005064_01 euxassay_005064_02 euxassay_005064_03 euxassay_005064_04 euxassay_005064_05
EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531
euxassay_005064_06 euxassay_005064_07 euxassay_005064_08 euxassay_005064_09 euxassay_005064_10
EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531
euxassay_005064_11 euxassay_005064_12 euxassay_005064_13 euxassay_005064_14 euxassay_005064_15
EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531 EMAGE:31531
euxassay_005064_16 euxassay_005064_17 euxassay_005064_18 euxassay_005064_19 euxassay_005064_20
EMAGE:31531 EMAGE:31531
euxassay_005064_21 euxassay_005064_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 06 09 10
spinal cord
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 09 10 13 weak expression: see section 07 08 14
not examined not examined
regionalnot examined expression: see section 01 02 03 04 20 21 22
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19
nasal cavity respiratory epithelium
weak weak
regionalweak expression: see section 10 11 12 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 08 09 10 11 13 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T644
Entity Detected:Npm1, nucleophosmin 1 ( MGI:106184)
Sequence:sense strand is shown

>T644
GCCATGGAGGAGACAACGCCCCCACTGCAAGCCGGCAGCAAGCCGCACCTTGAGAAGTTGACCCTAGGCG
TCACTCGCATCCTGGAATCTTCCCCAGGTGTGACCGAGGTGAGCATAATAGAAAAGCTGCCTGCTGAGCG
TCATATGATTTCTTCATGGGAACAGAAAAACAATTGTGTGATGCCTGAGGATGTGAGAAACTTCTACTTG
ATGACCAATGGTTTTCACATGACCTGGAGTGTGAAGCTAGATGAGCACATTATTCCACTGGGAAGCATGG
TGATTAACGGCATTTCAAAACTGACTCAGCTCATCCAGTCTTCTGTGTACTCACTTCCTAATGCACCAAC
TCTGGCAGACCTAGAGGACGATACTCAAGAAGGAAATGAAGACCACCAGCTAGAGAAGCCTCACTTTGAC
TGTCGCAGTGCAATATTTGAGCT
Notes:The probe template was PCR amplified from IMAGE:1887190 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1887190 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005064 same experiment
 EMAGE:31530 same assay
 EMAGE:30406 same embryo
 EMAGE:30617 same embryo
 EMAGE:31530 same embryo
 EMAGE:31558 same embryo
 EMAGE:30622 same embryo
 EMAGE:31610 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS