Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31817

Myod1 myogenic differentiation 1 ( MGI:97275)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817
euxassay_006193_01 euxassay_006193_02 euxassay_006193_03 euxassay_006193_04 euxassay_006193_05
EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817
euxassay_006193_06 euxassay_006193_07 euxassay_006193_08 euxassay_006193_09 euxassay_006193_10
EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817
euxassay_006193_11 euxassay_006193_12 euxassay_006193_13 euxassay_006193_14 euxassay_006193_15
EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817
euxassay_006193_16 euxassay_006193_17 euxassay_006193_18 euxassay_006193_19 euxassay_006193_20
EMAGE:31817 EMAGE:31817 EMAGE:31817 EMAGE:31817
euxassay_006193_21 euxassay_006193_22 euxassay_006193_23 euxassay_006193_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
upper arm mesenchyme
strong strong
regionalstrong expression: see section 21 22 23 24
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24
upper leg mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 18 19 20 21 22 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm mesenchyme
strong strong
regionalstrong expression: see section 23 24
foot mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 17 18 19
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
tongue muscle
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T554
Entity Detected:Myod1, myogenic differentiation 1 ( MGI:97275)
Sequence:sense strand is shown

>T554
TCTCAGNCTGTTGGCTACTGGTTAATAGCCCAGGGCGCCTGGCGCGAAGCTAGGGGCCAGGACGCCCCAG
GACACGACTGCTTTCTTCACCACACCTCTGACAGGACAGGACAGGGAGGAGGGGTAGAGGACAGCCGGTG
TGCATTCCAACCCACAGAACCTTTGTCATTGTACTGTTGGGGTTCCGGAGTGGCAGAAAGTTAAGACGAC
TCTCACGGCTTGGGTTGAGGCTGGACCCAGGAACTGGGATATGGAGCTTCTATCGCCGCCACTCCGGGAC
ATAGACTTGACAGGCCCCGACGGCTCTCTCTGCTCCTTTGAGACAGCAGACGACTTCTATGATGATCCGT
GTTTCGACTCACCAGACCTGCGCTTTTTTGAGGACCTGGACCCGCGCCTGGTGCACGTGGGAGCCCTCCT
GAAACCGGAGGAGCACGCACACTTCTCTACTGCGGTGCACCCAGGCCCAGGCGCTCGTGAGGATGAGCAT
GTGCGCGCGCCCAGCGGGCACCACCAGGCGGGTCGCTGCTTGCTGTGGGCCTG
Notes:The probe template was PCR amplified from IMAGE:1499265 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1499265 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006193 same experiment
 EMAGE:30927 same embryo
 EMAGE:31784 same embryo
 EMAGE:30870 same embryo
 EMAGE:30011 same embryo
 EMAGE:30843 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS