Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13630

Smad5 MAD homolog 5 (Drosophila) ( MGI:1328787)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630
"Pseudo-wholemount" of euxassay_019553. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019553_01 euxassay_019553_02 euxassay_019553_03 euxassay_019553_04
EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630
euxassay_019553_05 euxassay_019553_06 euxassay_019553_07 euxassay_019553_08 euxassay_019553_09
EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630
euxassay_019553_10 euxassay_019553_11 euxassay_019553_12 euxassay_019553_13 euxassay_019553_14
EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630
euxassay_019553_15 euxassay_019553_16 euxassay_019553_17 euxassay_019553_18 euxassay_019553_19
EMAGE:13630 EMAGE:13630 EMAGE:13630 EMAGE:13630
euxassay_019553_20 euxassay_019553_21 euxassay_019553_22 euxassay_019553_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13630Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13630_wholemount_strong.wlz
13630_wholemount_moderate.wlz
13630_wholemount_weak.wlz
13630_wholemount_possible.wlz
13630_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13630_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
spleen primordium
strong strong
regionalstrong expression: see section 04 05 06 moderate expression: see section 07 08
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 07 08 09 10 17 18 19
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 18 20 weak expression: see section 19 21
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 05 06 08 09 moderate expression: see section 03 04 07
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 05 moderate expression: see section 03 04 06 07 08 09 10 15 16 17 18 19 20 21 22 23 weak expression: see section 11 14
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 09 10 12 13 14 20 21 22 23 weak expression: see section 07 08 11 15 16 17 18 19
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 12 13 14 weak expression: see section 11 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
weak weak
regionalweak expression: see section 15 16
saccule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 weak expression: see section 05 17 18 19 20 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15 16
lower jaw molar
weak weak
regionalweak expression: see section 18 19
upper jaw incisor
weak weak
regionalweak expression: see section 09 10 11 14 15
upper jaw molar
weak weak
regionalweak expression: see section 18 19
metanephros
strong strong
regionalstrong expression: see section 18 20 21 22 moderate expression: see section 07 08 09 11 17 19
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 12 13 14 16 17 18 20 21 22 23 weak expression: see section 04 11 15 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55178
Entity Detected:Smad5, MAD homolog 5 (Drosophila) ( MGI:1328787)
Sequence:sense strand is shown

>T55178
GGGTATTTCCCTCACAGCAGTAGGATTTTCCCTTTAGGAGATACCAGTTCTTCATCTTTCTTGTGAAAAT
AATGCCTTTATGGGGAGTGAAGATTAAGGAGTTGTTTCTACACTAACAGAATTCTATTTGATGGACAACT
TGGACAGTTCTGTGGACTTGGGTGGGTTCTAGTGTGCTAAGAAGGATAACAGTATTTAATAGTGTCTGTC
ATCAGGCCTTGCTCATCTCCCTGTCTAGGGCTGTAGGTCAGTGCTCGAGCACTTAGCAGGCATCGAGTCT
AGTGTTCAGTGCCCAGCATTGCACAGAACTCAGAATATATCTGTACTGAAACTGAAGTGACCACCTACAA
CCAGGTGGTATGCCAGAACCACAGAAAGGAGATTCACGGTGATGTGTTTAAAGCATTGGGCTGGTGACGG
TTGCTGTGTAGTAATGACCTCTTCCTCAGCAAAGAGAGTCCTGGAGCAGGCTGTCCTCAGAAGAGGGAAG
GGACTGGTGTGCTCCTTGTGCAGATAACTTAGTGTATAAATCGGCATGAGTAGCTATCCTTTAAGGATTT
GTTTGAAGTTACTCTTTGTAAAAAGTTGAGAATTTTGTGTGCAGTTGGGCACATGCTTGCCCTTCCCCCA
CCCGCCATAGTCCTGCCTCTCTTGCTGTGAACTGGTGTCAGCTACAACACTCCAGCTAGGTCTGAGCTCT
TTTGAGAGAAGGTCTCGTAGAGCACCATTCTCAGAGAGAAGCTAAAGCATGGGGAGCCTTAGGACGGTCA
GGCAATGCACTCTTTACCACGGCTGGCTAAGGCTGCAGCTTGACCGTCCTTACCTAAATCAGGTAAGAAT
GTGATTACAGAGCGAGTGCTTGTGTTCCCCGGCCTGCCTTCTCCGAGGAAGATGCTTCATCCGAGGATGA
TGCAGAGCAGACGATG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GGGTATTTCCCTCACAGCAG; Reverse Primer - name:unspecified, sequence:CATCGTCTGCTCTGCATCAT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13634 same embryo
 EMAGE:13629 same embryo
 EMAGE:13633 same embryo
 EMAGE:13632 same embryo
 EMAGE:13631 same embryo
 EurExpress:euxassay_019553 same experiment
 MGI:4828316 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS